Incidental Mutation 'R7718:Rhbdl2'
ID595021
Institutional Source Beutler Lab
Gene Symbol Rhbdl2
Ensembl Gene ENSMUSG00000043333
Gene Namerhomboid like 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7718 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location123787874-123829904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123824919 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 222 (I222K)
Ref Sequence ENSEMBL: ENSMUSP00000101810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053202] [ENSMUST00000106204]
Predicted Effect probably damaging
Transcript: ENSMUST00000053202
AA Change: I222K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054546
Gene: ENSMUSG00000043333
AA Change: I222K

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Rhomboid 113 268 7.1e-39 PFAM
transmembrane domain 277 299 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106204
AA Change: I222K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101810
Gene: ENSMUSG00000043333
AA Change: I222K

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Rhomboid 113 268 1.8e-38 PFAM
transmembrane domain 277 299 N/A INTRINSIC
Meta Mutation Damage Score 0.2057 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the rhomboid family of integral membrane proteins. This family contains proteins that are related to Drosophila rhomboid protein. Members of this family are found in both prokaryotes and eukaryotes and are thought to function as intramembrane serine proteases. The encoded protein is thought to release soluble growth factors by proteolytic cleavage of certain membrane-bound substrates, including ephrin B2 and ephrin B3. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik G A 6: 50,589,098 probably null Het
9530053A07Rik T C 7: 28,147,201 F1106S probably damaging Het
A430033K04Rik A T 5: 138,647,860 H669L possibly damaging Het
A930017K11Rik T A 17: 25,947,024 R430* probably null Het
Abcb1a A T 5: 8,715,788 N700I probably damaging Het
Abcc6 T C 7: 45,977,392 K1414E possibly damaging Het
Adcy5 T C 16: 35,280,415 V779A probably benign Het
Agap2 A G 10: 127,079,865 S82G possibly damaging Het
Aldh1l1 A G 6: 90,598,323 N864S probably damaging Het
Ang2 A T 14: 51,195,760 V55E probably benign Het
Ank2 A G 3: 126,965,013 M179T possibly damaging Het
Atrnl1 T A 19: 57,740,183 C1090* probably null Het
Atxn1l A G 8: 109,733,234 L132P probably damaging Het
Bptf A G 11: 107,081,456 V862A possibly damaging Het
Capn11 C A 17: 45,643,781 K143N probably damaging Het
Card6 A G 15: 5,099,787 V709A possibly damaging Het
Cavin4 C T 4: 48,671,984 A143V probably benign Het
Cntn5 A G 9: 9,984,128 I160T probably benign Het
Cyp2c40 T A 19: 39,767,338 N511Y probably benign Het
Dsc2 A T 18: 20,041,778 I480N probably damaging Het
Elf2 G T 3: 51,265,964 probably benign Het
Enoph1 T C 5: 100,062,160 V133A possibly damaging Het
Ezh2 A T 6: 47,554,191 D186E probably benign Het
Fam196b T C 11: 34,402,539 S194P probably benign Het
Gfra1 T C 19: 58,453,457 D14G possibly damaging Het
Gm9573 T C 17: 35,622,836 T153A unknown Het
Gmip C T 8: 69,817,733 R698W probably damaging Het
Grk4 A G 5: 34,694,816 N135D probably benign Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Htatip2 T G 7: 49,770,884 H159Q possibly damaging Het
Igfn1 T C 1: 135,969,036 E1264G probably benign Het
Katnb1 T A 8: 95,095,208 V223E possibly damaging Het
Klra6 AGG AG 6: 130,013,352 probably null Het
Masp2 C T 4: 148,602,747 R29C probably damaging Het
Mcm3 A T 1: 20,817,274 C123* probably null Het
Mdn1 T C 4: 32,718,420 V2225A probably damaging Het
Me1 A G 9: 86,679,900 L44S probably damaging Het
Mlxip A G 5: 123,445,514 N380S probably benign Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Myocd A T 11: 65,218,626 D106E probably damaging Het
Oat T C 7: 132,558,259 I411V probably benign Het
Olfr1085 A G 2: 86,658,029 V143A probably benign Het
Olfr483 T C 7: 108,103,648 V113A probably benign Het
Olfr715 A T 7: 107,128,718 V225D probably damaging Het
Orc2 A T 1: 58,480,317 H246Q possibly damaging Het
Pank4 A G 4: 154,974,643 E411G probably damaging Het
Patl2 A T 2: 122,126,774 probably null Het
Pcdhb15 A G 18: 37,475,163 N483D probably damaging Het
Pcdhb20 A G 18: 37,505,651 D410G probably damaging Het
Pdcl2 A G 5: 76,317,999 C125R probably damaging Het
Peli3 C G 19: 4,934,556 probably null Het
Pkd1 A G 17: 24,586,500 D3313G probably benign Het
Plec A C 15: 76,177,439 M2766R probably damaging Het
Ppargc1a C T 5: 51,498,162 V99M probably damaging Het
Psg19 G A 7: 18,792,443 A374V probably benign Het
Psmd7 A T 8: 107,586,629 F54L possibly damaging Het
Ptbp2 C T 3: 119,720,988 G397R probably null Het
Ranbp3 A G 17: 56,696,718 D39G probably damaging Het
Rcor3 T C 1: 192,101,721 T406A probably benign Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Rpia A T 6: 70,766,618 M283K probably damaging Het
Rps6kc1 T C 1: 190,871,825 D200G probably benign Het
Sipa1l1 A T 12: 82,342,497 K499M probably damaging Het
Slc5a4b A G 10: 76,070,573 L404P probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St7 A C 6: 17,854,999 T312P probably damaging Het
Strbp T C 2: 37,625,282 E244G probably damaging Het
Tbc1d8 T G 1: 39,376,980 T871P probably benign Het
Tcp1 T A 17: 12,922,162 I286N probably damaging Het
Tead3 C A 17: 28,333,517 V327F probably damaging Het
Tmem132c A T 5: 127,563,440 T892S probably benign Het
Trmt2a T C 16: 18,250,623 S65P probably benign Het
Ubp1 A G 9: 113,973,529 N479S possibly damaging Het
Ubtfl1 A T 9: 18,409,231 L18F possibly damaging Het
Uevld T G 7: 46,938,056 M299L probably benign Het
Unc13b T A 4: 43,173,854 Y1561N unknown Het
Ylpm1 A G 12: 85,029,122 K874E probably damaging Het
Zbtb37 G A 1: 161,032,232 R168W possibly damaging Het
Other mutations in Rhbdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Rhbdl2 APN 4 123829657 missense probably benign
IGL02111:Rhbdl2 APN 4 123822837 missense probably damaging 1.00
IGL03381:Rhbdl2 APN 4 123822817 missense possibly damaging 0.84
IGL03410:Rhbdl2 APN 4 123829670 nonsense probably null
R0039:Rhbdl2 UTSW 4 123810029 missense probably benign 0.02
R1292:Rhbdl2 UTSW 4 123829642 missense possibly damaging 0.69
R2024:Rhbdl2 UTSW 4 123826872 missense probably damaging 1.00
R2120:Rhbdl2 UTSW 4 123824919 missense probably damaging 1.00
R4364:Rhbdl2 UTSW 4 123809935 start codon destroyed probably null 0.87
R4366:Rhbdl2 UTSW 4 123809935 start codon destroyed probably null 0.87
R4413:Rhbdl2 UTSW 4 123810087 missense probably benign 0.04
R4749:Rhbdl2 UTSW 4 123826901 critical splice donor site probably null
R5069:Rhbdl2 UTSW 4 123817917 nonsense probably null
R5303:Rhbdl2 UTSW 4 123810221 intron probably benign
R5951:Rhbdl2 UTSW 4 123814327 missense probably benign 0.00
R7147:Rhbdl2 UTSW 4 123810115 missense probably damaging 1.00
R7171:Rhbdl2 UTSW 4 123814256 missense possibly damaging 0.95
R7337:Rhbdl2 UTSW 4 123817866 missense possibly damaging 0.91
R7374:Rhbdl2 UTSW 4 123817865 missense probably benign 0.01
R7411:Rhbdl2 UTSW 4 123829642 missense possibly damaging 0.69
R8152:Rhbdl2 UTSW 4 123824918 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CAAAGTAGAGCAGCACTGGC -3'
(R):5'- CTAAGTGAAGCTATTGTGAGAGGC -3'

Sequencing Primer
(F):5'- GTCTTTAATCCCAGCACTCAGGAGG -3'
(R):5'- CTATTGTGAGAGGCAAGACGCAC -3'
Posted On2019-11-12