Incidental Mutation 'R7718:Grk4'
ID595025
Institutional Source Beutler Lab
Gene Symbol Grk4
Ensembl Gene ENSMUSG00000052783
Gene NameG protein-coupled receptor kinase 4
SynonymsGprk2l, A830025H08Rik
Accession Numbers

Genbank: NM_019497.2, NM_001080743.1

Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R7718 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location34660379-34755305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34694816 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 135 (N135D)
Ref Sequence ENSEMBL: ENSMUSP00000001112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001112] [ENSMUST00000074651]
Predicted Effect probably benign
Transcript: ENSMUST00000001112
AA Change: N135D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001112
Gene: ENSMUSG00000052783
AA Change: N135D

DomainStartEndE-ValueType
RGS 51 171 1.61e-31 SMART
S_TKc 186 448 7.78e-85 SMART
S_TK_X 449 528 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074651
AA Change: N135D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074223
Gene: ENSMUSG00000052783
AA Change: N135D

DomainStartEndE-ValueType
RGS 51 163 1.39e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating its deactivation. This gene has been linked to both genetic and acquired hypertension. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice heterozygous for a knock-out allele are viable, fertile and overtly normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(2)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,147,201 F1106S probably damaging Het
A430033K04Rik A T 5: 138,647,860 H669L possibly damaging Het
A930017K11Rik T A 17: 25,947,024 R430* probably null Het
Abcb1a A T 5: 8,715,788 N700I probably damaging Het
Abcc6 T C 7: 45,977,392 K1414E possibly damaging Het
Adcy5 T C 16: 35,280,415 V779A probably benign Het
Agap2 A G 10: 127,079,865 S82G possibly damaging Het
Aldh1l1 A G 6: 90,598,323 N864S probably damaging Het
Ang2 A T 14: 51,195,760 V55E probably benign Het
Ank2 A G 3: 126,965,013 M179T possibly damaging Het
Atrnl1 T A 19: 57,740,183 C1090* probably null Het
Atxn1l A G 8: 109,733,234 L132P probably damaging Het
Bptf A G 11: 107,081,456 V862A possibly damaging Het
Capn11 C A 17: 45,643,781 K143N probably damaging Het
Card6 A G 15: 5,099,787 V709A possibly damaging Het
Cavin4 C T 4: 48,671,984 A143V probably benign Het
Cntn5 A G 9: 9,984,128 I160T probably benign Het
Cyp2c40 T A 19: 39,767,338 N511Y probably benign Het
Dsc2 A T 18: 20,041,778 I480N probably damaging Het
Enoph1 T C 5: 100,062,160 V133A possibly damaging Het
Ezh2 A T 6: 47,554,191 D186E probably benign Het
Fam196b T C 11: 34,402,539 S194P probably benign Het
Gfra1 T C 19: 58,453,457 D14G possibly damaging Het
Gm9573 T C 17: 35,622,836 T153A unknown Het
Gmip C T 8: 69,817,733 R698W probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Htatip2 T G 7: 49,770,884 H159Q possibly damaging Het
Igfn1 T C 1: 135,969,036 E1264G probably benign Het
Katnb1 T A 8: 95,095,208 V223E possibly damaging Het
Klra6 AGG AG 6: 130,013,352 probably null Het
Masp2 C T 4: 148,602,747 R29C probably damaging Het
Mcm3 A T 1: 20,817,274 C123* probably null Het
Mdn1 T C 4: 32,718,420 V2225A probably damaging Het
Me1 A G 9: 86,679,900 L44S probably damaging Het
Mlxip A G 5: 123,445,514 N380S probably benign Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Myocd A T 11: 65,218,626 D106E probably damaging Het
Oat T C 7: 132,558,259 I411V probably benign Het
Olfr1085 A G 2: 86,658,029 V143A probably benign Het
Olfr483 T C 7: 108,103,648 V113A probably benign Het
Olfr715 A T 7: 107,128,718 V225D probably damaging Het
Orc2 A T 1: 58,480,317 H246Q possibly damaging Het
Pank4 A G 4: 154,974,643 E411G probably damaging Het
Pcdhb15 A G 18: 37,475,163 N483D probably damaging Het
Pcdhb20 A G 18: 37,505,651 D410G probably damaging Het
Pdcl2 A G 5: 76,317,999 C125R probably damaging Het
Peli3 C G 19: 4,934,556 probably null Het
Pkd1 A G 17: 24,586,500 D3313G probably benign Het
Plec A C 15: 76,177,439 M2766R probably damaging Het
Ppargc1a C T 5: 51,498,162 V99M probably damaging Het
Psg19 G A 7: 18,792,443 A374V probably benign Het
Psmd7 A T 8: 107,586,629 F54L possibly damaging Het
Ptbp2 C T 3: 119,720,988 G397R probably null Het
Ranbp3 A G 17: 56,696,718 D39G probably damaging Het
Rcor3 T C 1: 192,101,721 T406A probably benign Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Rpia A T 6: 70,766,618 M283K probably damaging Het
Rps6kc1 T C 1: 190,871,825 D200G probably benign Het
Sipa1l1 A T 12: 82,342,497 K499M probably damaging Het
Slc5a4b A G 10: 76,070,573 L404P probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St7 A C 6: 17,854,999 T312P probably damaging Het
Strbp T C 2: 37,625,282 E244G probably damaging Het
Tbc1d8 T G 1: 39,376,980 T871P probably benign Het
Tcp1 T A 17: 12,922,162 I286N probably damaging Het
Tead3 C A 17: 28,333,517 V327F probably damaging Het
Tmem132c A T 5: 127,563,440 T892S probably benign Het
Trmt2a T C 16: 18,250,623 S65P probably benign Het
Ubp1 A G 9: 113,973,529 N479S possibly damaging Het
Ubtfl1 A T 9: 18,409,231 L18F possibly damaging Het
Uevld T G 7: 46,938,056 M299L probably benign Het
Unc13b T A 4: 43,173,854 Y1561N unknown Het
Ylpm1 A G 12: 85,029,122 K874E probably damaging Het
Zbtb37 G A 1: 161,032,232 R168W possibly damaging Het
Other mutations in Grk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Grk4 APN 5 34716290 missense probably damaging 0.99
IGL00574:Grk4 APN 5 34694818 missense probably benign 0.00
IGL02127:Grk4 APN 5 34710186 missense probably benign 0.00
IGL02191:Grk4 APN 5 34755189 missense probably benign 0.27
IGL02227:Grk4 APN 5 34694782 missense probably benign 0.06
IGL03152:Grk4 APN 5 34745357 missense probably damaging 1.00
IGL03214:Grk4 APN 5 34752209 missense probably benign
F5426:Grk4 UTSW 5 34745159 splice site probably benign
R0110:Grk4 UTSW 5 34716213 missense probably damaging 0.97
R0469:Grk4 UTSW 5 34716213 missense probably damaging 0.97
R0671:Grk4 UTSW 5 34748267 missense probably benign 0.04
R1466:Grk4 UTSW 5 34694750 missense probably benign 0.02
R1466:Grk4 UTSW 5 34694750 missense probably benign 0.02
R1584:Grk4 UTSW 5 34694750 missense probably benign 0.02
R1605:Grk4 UTSW 5 34674557 missense probably damaging 0.98
R1607:Grk4 UTSW 5 34731538 missense probably benign 0.01
R1903:Grk4 UTSW 5 34676187 splice site probably null
R2352:Grk4 UTSW 5 34669176 missense probably benign 0.04
R4561:Grk4 UTSW 5 34694813 missense probably benign 0.00
R4580:Grk4 UTSW 5 34660981 missense probably damaging 1.00
R4807:Grk4 UTSW 5 34752208 missense probably benign
R5412:Grk4 UTSW 5 34745268 missense probably benign 0.00
R5905:Grk4 UTSW 5 34711730 missense probably damaging 1.00
R6360:Grk4 UTSW 5 34674537 missense probably damaging 1.00
R6604:Grk4 UTSW 5 34719864 missense probably damaging 1.00
R6865:Grk4 UTSW 5 34731550 missense probably damaging 1.00
R7265:Grk4 UTSW 5 34716264 missense probably damaging 0.96
R7394:Grk4 UTSW 5 34751618 missense probably benign
R7821:Grk4 UTSW 5 34710209 missense probably damaging 1.00
R8074:Grk4 UTSW 5 34676138 missense probably benign 0.30
X0064:Grk4 UTSW 5 34719884 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GGTACTGGGTGATACTTTGACTT -3'
(R):5'- CTTTTGTCTTGGCGGTTACCA -3'

Sequencing Primer
(F):5'- GTAGAGTAGGCATTAGGTTC -3'
(R):5'- TACCATCCTAGAGCCTTAGAAGTAGG -3'
Posted On2019-11-12