Incidental Mutation 'R7718:Tmem132c'
ID 595030
Institutional Source Beutler Lab
Gene Symbol Tmem132c
Ensembl Gene ENSMUSG00000034324
Gene Name transmembrane protein 132C
Synonyms 2810482M11Rik, 4632425D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R7718 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 127241808-127565793 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 127563440 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 892 (T892S)
Ref Sequence ENSEMBL: ENSMUSP00000113090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119026]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000119026
AA Change: T892S

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113090
Gene: ENSMUSG00000034324
AA Change: T892S

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
Pfam:TMEM132D_N 58 187 1.2e-54 PFAM
Pfam:TMEM132 444 787 4.5e-143 PFAM
Pfam:TMEM132D_C 892 980 2.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145748
SMART Domains Protein: ENSMUSP00000121783
Gene: ENSMUSG00000034324

DomainStartEndE-ValueType
Pfam:TMEM132 1 112 6.2e-31 PFAM
Meta Mutation Damage Score 0.2195 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik G A 6: 50,589,098 probably null Het
9530053A07Rik T C 7: 28,147,201 F1106S probably damaging Het
A430033K04Rik A T 5: 138,647,860 H669L possibly damaging Het
A930017K11Rik T A 17: 25,947,024 R430* probably null Het
Abcb1a A T 5: 8,715,788 N700I probably damaging Het
Abcc6 T C 7: 45,977,392 K1414E possibly damaging Het
Adcy5 T C 16: 35,280,415 V779A probably benign Het
Agap2 A G 10: 127,079,865 S82G possibly damaging Het
Aldh1l1 A G 6: 90,598,323 N864S probably damaging Het
Ang2 A T 14: 51,195,760 V55E probably benign Het
Ank2 A G 3: 126,965,013 M179T possibly damaging Het
Atrnl1 T A 19: 57,740,183 C1090* probably null Het
Atxn1l A G 8: 109,733,234 L132P probably damaging Het
Bptf A G 11: 107,081,456 V862A possibly damaging Het
Capn11 C A 17: 45,643,781 K143N probably damaging Het
Card6 A G 15: 5,099,787 V709A possibly damaging Het
Cavin4 C T 4: 48,671,984 A143V probably benign Het
Cntn5 A G 9: 9,984,128 I160T probably benign Het
Cyp2c40 T A 19: 39,767,338 N511Y probably benign Het
Dsc2 A T 18: 20,041,778 I480N probably damaging Het
Elf2 G T 3: 51,265,964 probably benign Het
Enoph1 T C 5: 100,062,160 V133A possibly damaging Het
Ezh2 A T 6: 47,554,191 D186E probably benign Het
Fam196b T C 11: 34,402,539 S194P probably benign Het
Gfra1 T C 19: 58,453,457 D14G possibly damaging Het
Gm9573 T C 17: 35,622,836 T153A unknown Het
Gmip C T 8: 69,817,733 R698W probably damaging Het
Grk4 A G 5: 34,694,816 N135D probably benign Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Htatip2 T G 7: 49,770,884 H159Q possibly damaging Het
Igfn1 T C 1: 135,969,036 E1264G probably benign Het
Katnb1 T A 8: 95,095,208 V223E possibly damaging Het
Klra6 AGG AG 6: 130,013,352 probably null Het
Masp2 C T 4: 148,602,747 R29C probably damaging Het
Mcm3 A T 1: 20,817,274 C123* probably null Het
Mdn1 T C 4: 32,718,420 V2225A probably damaging Het
Me1 A G 9: 86,679,900 L44S probably damaging Het
Mlxip A G 5: 123,445,514 N380S probably benign Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Myocd A T 11: 65,218,626 D106E probably damaging Het
Oat T C 7: 132,558,259 I411V probably benign Het
Olfr1085 A G 2: 86,658,029 V143A probably benign Het
Olfr483 T C 7: 108,103,648 V113A probably benign Het
Olfr715 A T 7: 107,128,718 V225D probably damaging Het
Orc2 A T 1: 58,480,317 H246Q possibly damaging Het
Pank4 A G 4: 154,974,643 E411G probably damaging Het
Patl2 A T 2: 122,126,774 probably null Het
Pcdhb15 A G 18: 37,475,163 N483D probably damaging Het
Pcdhb20 A G 18: 37,505,651 D410G probably damaging Het
Pdcl2 A G 5: 76,317,999 C125R probably damaging Het
Peli3 C G 19: 4,934,556 probably null Het
Pkd1 A G 17: 24,586,500 D3313G probably benign Het
Plec A C 15: 76,177,439 M2766R probably damaging Het
Ppargc1a C T 5: 51,498,162 V99M probably damaging Het
Psg19 G A 7: 18,792,443 A374V probably benign Het
Psmd7 A T 8: 107,586,629 F54L possibly damaging Het
Ptbp2 C T 3: 119,720,988 G397R probably null Het
Ranbp3 A G 17: 56,696,718 D39G probably damaging Het
Rcor3 T C 1: 192,101,721 T406A probably benign Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Rpia A T 6: 70,766,618 M283K probably damaging Het
Rps6kc1 T C 1: 190,871,825 D200G probably benign Het
Sipa1l1 A T 12: 82,342,497 K499M probably damaging Het
Slc5a4b A G 10: 76,070,573 L404P probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St7 A C 6: 17,854,999 T312P probably damaging Het
Strbp T C 2: 37,625,282 E244G probably damaging Het
Tbc1d8 T G 1: 39,376,980 T871P probably benign Het
Tcp1 T A 17: 12,922,162 I286N probably damaging Het
Tead3 C A 17: 28,333,517 V327F probably damaging Het
Trmt2a T C 16: 18,250,623 S65P probably benign Het
Ubp1 A G 9: 113,973,529 N479S possibly damaging Het
Ubtfl1 A T 9: 18,409,231 L18F possibly damaging Het
Uevld T G 7: 46,938,056 M299L probably benign Het
Unc13b T A 4: 43,173,854 Y1561N unknown Het
Ylpm1 A G 12: 85,029,122 K874E probably damaging Het
Zbtb37 G A 1: 161,032,232 R168W possibly damaging Het
Other mutations in Tmem132c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Tmem132c APN 5 127563242 missense possibly damaging 0.95
IGL00985:Tmem132c APN 5 127504866 missense probably damaging 0.99
IGL01599:Tmem132c APN 5 127359552 splice site probably benign
IGL01750:Tmem132c APN 5 127462959 missense possibly damaging 0.91
IGL01893:Tmem132c APN 5 127463029 missense possibly damaging 0.51
IGL02143:Tmem132c APN 5 127563402 missense probably benign 0.03
IGL02164:Tmem132c APN 5 127536377 missense probably damaging 1.00
IGL02252:Tmem132c APN 5 127462927 missense possibly damaging 0.91
IGL02527:Tmem132c APN 5 127359611 missense possibly damaging 0.95
IGL02584:Tmem132c APN 5 127504999 missense probably damaging 1.00
IGL02878:Tmem132c APN 5 127563090 missense probably damaging 0.99
IGL03065:Tmem132c APN 5 127563624 missense probably damaging 1.00
IGL03120:Tmem132c APN 5 127563384 missense probably benign 0.06
IGL03380:Tmem132c APN 5 127536442 missense probably benign 0.00
IGL03387:Tmem132c APN 5 127563720 missense probably benign 0.00
R0106:Tmem132c UTSW 5 127554669 missense possibly damaging 0.94
R0106:Tmem132c UTSW 5 127554669 missense possibly damaging 0.94
R0415:Tmem132c UTSW 5 127563705 missense probably damaging 1.00
R0607:Tmem132c UTSW 5 127563553 nonsense probably null
R1413:Tmem132c UTSW 5 127563567 missense probably damaging 1.00
R1531:Tmem132c UTSW 5 127359891 missense probably damaging 1.00
R1648:Tmem132c UTSW 5 127463056 splice site probably benign
R2148:Tmem132c UTSW 5 127462962 missense probably damaging 1.00
R2149:Tmem132c UTSW 5 127462962 missense probably damaging 1.00
R2259:Tmem132c UTSW 5 127504924 missense probably benign 0.01
R3853:Tmem132c UTSW 5 127359869 missense probably benign 0.00
R4204:Tmem132c UTSW 5 127563765 missense possibly damaging 0.73
R4543:Tmem132c UTSW 5 127504977 missense probably benign 0.00
R4701:Tmem132c UTSW 5 127564496 unclassified probably benign
R5017:Tmem132c UTSW 5 127563350 missense probably benign 0.13
R5037:Tmem132c UTSW 5 127553135 missense probably benign 0.42
R5327:Tmem132c UTSW 5 127563752 missense possibly damaging 0.50
R5423:Tmem132c UTSW 5 127563843 missense probably benign 0.02
R5548:Tmem132c UTSW 5 127551523 nonsense probably null
R6425:Tmem132c UTSW 5 127553265 missense possibly damaging 0.95
R6717:Tmem132c UTSW 5 127564029 missense possibly damaging 0.93
R6899:Tmem132c UTSW 5 127551680 missense probably damaging 1.00
R7007:Tmem132c UTSW 5 127359615 missense probably damaging 1.00
R7297:Tmem132c UTSW 5 127360217 missense probably benign 0.06
R7326:Tmem132c UTSW 5 127564059 missense possibly damaging 0.51
R7386:Tmem132c UTSW 5 127563926 missense probably benign 0.16
R7504:Tmem132c UTSW 5 127554632 missense probably damaging 1.00
R7640:Tmem132c UTSW 5 127563006 missense probably damaging 1.00
R7762:Tmem132c UTSW 5 127554696 missense possibly damaging 0.90
R7818:Tmem132c UTSW 5 127564088 makesense probably null
R8117:Tmem132c UTSW 5 127360112 missense probably benign 0.22
R8425:Tmem132c UTSW 5 127564357 missense
R8749:Tmem132c UTSW 5 127359939 missense possibly damaging 0.75
R8771:Tmem132c UTSW 5 127360128 missense probably benign 0.00
R8798:Tmem132c UTSW 5 127360153 nonsense probably null
R9372:Tmem132c UTSW 5 127563081 missense probably damaging 1.00
X0067:Tmem132c UTSW 5 127536407 missense possibly damaging 0.79
Z1088:Tmem132c UTSW 5 127504921 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCAAGAACCATGCCAGTGAC -3'
(R):5'- TTGTGCCTGTACTTGAAGGC -3'

Sequencing Primer
(F):5'- TGACCGTCGGCAGAAGATTC -3'
(R):5'- CCTGTACTTGAAGGCAAAGGTG -3'
Posted On 2019-11-12