Incidental Mutation 'R7718:Aldh1l1'
ID595035
Institutional Source Beutler Lab
Gene Symbol Aldh1l1
Ensembl Gene ENSMUSG00000030088
Gene Namealdehyde dehydrogenase 1 family, member L1
SynonymsFthfd, 1810048F20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7718 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location90486427-90600203 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90598323 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 864 (N864S)
Ref Sequence ENSEMBL: ENSMUSP00000032175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032175] [ENSMUST00000130418] [ENSMUST00000204796]
Predicted Effect probably damaging
Transcript: ENSMUST00000032175
AA Change: N864S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032175
Gene: ENSMUSG00000030088
AA Change: N864S

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 6.9e-53 PFAM
Pfam:Formyl_trans_C 204 310 4e-18 PFAM
Pfam:PP-binding 325 391 3.7e-6 PFAM
Pfam:Aldedh 430 898 1.3e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130418
AA Change: N864S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114304
Gene: ENSMUSG00000030088
AA Change: N864S

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 7.4e-54 PFAM
Pfam:Formyl_trans_C 204 310 2.6e-18 PFAM
Pfam:Aldedh 430 898 1.7e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204796
SMART Domains Protein: ENSMUSP00000145380
Gene: ENSMUSG00000030088

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 3e-53 PFAM
Pfam:Formyl_trans_C 204 310 1.5e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of 10-formyltetrahydrofolate, nicotinamide adenine dinucleotide phosphate (NADP+), and water to tetrahydrofolate, NADPH, and carbon dioxide. The encoded protein belongs to the aldehyde dehydrogenase family. Loss of function or expression of this gene is associated with decreased apoptosis, increased cell motility, and cancer progression. There is an antisense transcript that overlaps on the opposite strand with this gene locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,147,201 F1106S probably damaging Het
A430033K04Rik A T 5: 138,647,860 H669L possibly damaging Het
A930017K11Rik T A 17: 25,947,024 R430* probably null Het
Abcb1a A T 5: 8,715,788 N700I probably damaging Het
Abcc6 T C 7: 45,977,392 K1414E possibly damaging Het
Adcy5 T C 16: 35,280,415 V779A probably benign Het
Agap2 A G 10: 127,079,865 S82G possibly damaging Het
Ang2 A T 14: 51,195,760 V55E probably benign Het
Ank2 A G 3: 126,965,013 M179T possibly damaging Het
Atrnl1 T A 19: 57,740,183 C1090* probably null Het
Atxn1l A G 8: 109,733,234 L132P probably damaging Het
Bptf A G 11: 107,081,456 V862A possibly damaging Het
Capn11 C A 17: 45,643,781 K143N probably damaging Het
Card6 A G 15: 5,099,787 V709A possibly damaging Het
Cavin4 C T 4: 48,671,984 A143V probably benign Het
Cntn5 A G 9: 9,984,128 I160T probably benign Het
Cyp2c40 T A 19: 39,767,338 N511Y probably benign Het
Dsc2 A T 18: 20,041,778 I480N probably damaging Het
Enoph1 T C 5: 100,062,160 V133A possibly damaging Het
Ezh2 A T 6: 47,554,191 D186E probably benign Het
Fam196b T C 11: 34,402,539 S194P probably benign Het
Gfra1 T C 19: 58,453,457 D14G possibly damaging Het
Gm9573 T C 17: 35,622,836 T153A unknown Het
Gmip C T 8: 69,817,733 R698W probably damaging Het
Grk4 A G 5: 34,694,816 N135D probably benign Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Htatip2 T G 7: 49,770,884 H159Q possibly damaging Het
Igfn1 T C 1: 135,969,036 E1264G probably benign Het
Katnb1 T A 8: 95,095,208 V223E possibly damaging Het
Klra6 AGG AG 6: 130,013,352 probably null Het
Masp2 C T 4: 148,602,747 R29C probably damaging Het
Mcm3 A T 1: 20,817,274 C123* probably null Het
Mdn1 T C 4: 32,718,420 V2225A probably damaging Het
Me1 A G 9: 86,679,900 L44S probably damaging Het
Mlxip A G 5: 123,445,514 N380S probably benign Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Myocd A T 11: 65,218,626 D106E probably damaging Het
Oat T C 7: 132,558,259 I411V probably benign Het
Olfr1085 A G 2: 86,658,029 V143A probably benign Het
Olfr483 T C 7: 108,103,648 V113A probably benign Het
Olfr715 A T 7: 107,128,718 V225D probably damaging Het
Orc2 A T 1: 58,480,317 H246Q possibly damaging Het
Pank4 A G 4: 154,974,643 E411G probably damaging Het
Pcdhb15 A G 18: 37,475,163 N483D probably damaging Het
Pcdhb20 A G 18: 37,505,651 D410G probably damaging Het
Pdcl2 A G 5: 76,317,999 C125R probably damaging Het
Peli3 C G 19: 4,934,556 probably null Het
Pkd1 A G 17: 24,586,500 D3313G probably benign Het
Plec A C 15: 76,177,439 M2766R probably damaging Het
Ppargc1a C T 5: 51,498,162 V99M probably damaging Het
Psg19 G A 7: 18,792,443 A374V probably benign Het
Psmd7 A T 8: 107,586,629 F54L possibly damaging Het
Ptbp2 C T 3: 119,720,988 G397R probably null Het
Ranbp3 A G 17: 56,696,718 D39G probably damaging Het
Rcor3 T C 1: 192,101,721 T406A probably benign Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Rpia A T 6: 70,766,618 M283K probably damaging Het
Rps6kc1 T C 1: 190,871,825 D200G probably benign Het
Sipa1l1 A T 12: 82,342,497 K499M probably damaging Het
Slc5a4b A G 10: 76,070,573 L404P probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St7 A C 6: 17,854,999 T312P probably damaging Het
Strbp T C 2: 37,625,282 E244G probably damaging Het
Tbc1d8 T G 1: 39,376,980 T871P probably benign Het
Tcp1 T A 17: 12,922,162 I286N probably damaging Het
Tead3 C A 17: 28,333,517 V327F probably damaging Het
Tmem132c A T 5: 127,563,440 T892S probably benign Het
Trmt2a T C 16: 18,250,623 S65P probably benign Het
Ubp1 A G 9: 113,973,529 N479S possibly damaging Het
Ubtfl1 A T 9: 18,409,231 L18F possibly damaging Het
Uevld T G 7: 46,938,056 M299L probably benign Het
Unc13b T A 4: 43,173,854 Y1561N unknown Het
Ylpm1 A G 12: 85,029,122 K874E probably damaging Het
Zbtb37 G A 1: 161,032,232 R168W possibly damaging Het
Other mutations in Aldh1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Aldh1l1 APN 6 90598380 missense probably damaging 1.00
IGL01350:Aldh1l1 APN 6 90559356 missense probably damaging 1.00
IGL01601:Aldh1l1 APN 6 90591841 missense probably damaging 1.00
IGL01686:Aldh1l1 APN 6 90559233 splice site probably benign
IGL01868:Aldh1l1 APN 6 90583230 nonsense probably null
IGL01941:Aldh1l1 APN 6 90562695 missense probably damaging 0.98
IGL01982:Aldh1l1 APN 6 90559863 missense probably benign 0.00
IGL02088:Aldh1l1 APN 6 90580590 splice site probably benign
IGL02159:Aldh1l1 APN 6 90594656 splice site probably benign
IGL02450:Aldh1l1 APN 6 90569873 missense probably benign 0.00
IGL02657:Aldh1l1 APN 6 90590794 missense probably damaging 1.00
IGL02839:Aldh1l1 APN 6 90569875 missense possibly damaging 0.95
R0149:Aldh1l1 UTSW 6 90589414 missense possibly damaging 0.85
R0206:Aldh1l1 UTSW 6 90569866 missense possibly damaging 0.88
R0206:Aldh1l1 UTSW 6 90569866 missense possibly damaging 0.88
R0418:Aldh1l1 UTSW 6 90569893 missense possibly damaging 0.49
R1121:Aldh1l1 UTSW 6 90589384 missense probably benign
R1467:Aldh1l1 UTSW 6 90571928 missense possibly damaging 0.90
R1467:Aldh1l1 UTSW 6 90571928 missense possibly damaging 0.90
R1649:Aldh1l1 UTSW 6 90564389 missense probably benign
R1793:Aldh1l1 UTSW 6 90577831 missense possibly damaging 0.92
R2043:Aldh1l1 UTSW 6 90557332 missense probably benign 0.05
R2044:Aldh1l1 UTSW 6 90562665 missense probably benign 0.00
R2229:Aldh1l1 UTSW 6 90583186 missense probably damaging 1.00
R2426:Aldh1l1 UTSW 6 90598284 missense probably damaging 0.99
R4109:Aldh1l1 UTSW 6 90562644 missense probably benign 0.04
R4818:Aldh1l1 UTSW 6 90596915 missense probably benign
R5214:Aldh1l1 UTSW 6 90563417 missense probably damaging 1.00
R5285:Aldh1l1 UTSW 6 90576770 nonsense probably null
R5426:Aldh1l1 UTSW 6 90559299 missense probably benign
R5516:Aldh1l1 UTSW 6 90596945 missense possibly damaging 0.95
R5970:Aldh1l1 UTSW 6 90597046 intron probably benign
R6235:Aldh1l1 UTSW 6 90564457 missense probably benign 0.44
R6322:Aldh1l1 UTSW 6 90562698 missense probably benign 0.03
R7053:Aldh1l1 UTSW 6 90563438 missense possibly damaging 0.50
R7125:Aldh1l1 UTSW 6 90576779 critical splice donor site probably null
R7128:Aldh1l1 UTSW 6 90563379 missense probably benign 0.23
R7142:Aldh1l1 UTSW 6 90563416 missense probably damaging 1.00
R7203:Aldh1l1 UTSW 6 90570800 missense probably benign 0.01
R7205:Aldh1l1 UTSW 6 90598275 missense probably damaging 0.97
R7477:Aldh1l1 UTSW 6 90598387 critical splice donor site probably null
R7669:Aldh1l1 UTSW 6 90570862 missense probably benign
R7788:Aldh1l1 UTSW 6 90569912 missense probably benign 0.20
RF007:Aldh1l1 UTSW 6 90598259 missense probably damaging 0.99
Z1176:Aldh1l1 UTSW 6 90557284 frame shift probably null
Z1176:Aldh1l1 UTSW 6 90583173 missense probably benign 0.11
Z1177:Aldh1l1 UTSW 6 90564449 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGGACGCTCTGAGCATC -3'
(R):5'- AGTCCCAAGAGTGTTCCCTC -3'

Sequencing Primer
(F):5'- GAGCATCTCTCAGGGAGTTC -3'
(R):5'- AAGAGTGTTCCCTCCCAGCTAG -3'
Posted On2019-11-12