Incidental Mutation 'R7718:Olfr715'
ID595044
Institutional Source Beutler Lab
Gene Symbol Olfr715
Ensembl Gene ENSMUSG00000060503
Gene Nameolfactory receptor 715
SynonymsMOR260-1, GA_x6K02T2PBJ9-9479517-9478573
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R7718 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location107125267-107131083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107128718 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 225 (V225D)
Ref Sequence ENSEMBL: ENSMUSP00000150168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076958] [ENSMUST00000214919]
Predicted Effect probably damaging
Transcript: ENSMUST00000076958
AA Change: V225D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076225
Gene: ENSMUSG00000060503
AA Change: V225D

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.6e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 222 1.4e-8 PFAM
Pfam:7tm_1 41 288 1.7e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214919
AA Change: V225D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,147,201 F1106S probably damaging Het
A430033K04Rik A T 5: 138,647,860 H669L possibly damaging Het
A930017K11Rik T A 17: 25,947,024 R430* probably null Het
Abcb1a A T 5: 8,715,788 N700I probably damaging Het
Abcc6 T C 7: 45,977,392 K1414E possibly damaging Het
Adcy5 T C 16: 35,280,415 V779A probably benign Het
Agap2 A G 10: 127,079,865 S82G possibly damaging Het
Aldh1l1 A G 6: 90,598,323 N864S probably damaging Het
Ang2 A T 14: 51,195,760 V55E probably benign Het
Ank2 A G 3: 126,965,013 M179T possibly damaging Het
Atrnl1 T A 19: 57,740,183 C1090* probably null Het
Atxn1l A G 8: 109,733,234 L132P probably damaging Het
Bptf A G 11: 107,081,456 V862A possibly damaging Het
Capn11 C A 17: 45,643,781 K143N probably damaging Het
Card6 A G 15: 5,099,787 V709A possibly damaging Het
Cavin4 C T 4: 48,671,984 A143V probably benign Het
Cntn5 A G 9: 9,984,128 I160T probably benign Het
Cyp2c40 T A 19: 39,767,338 N511Y probably benign Het
Dsc2 A T 18: 20,041,778 I480N probably damaging Het
Enoph1 T C 5: 100,062,160 V133A possibly damaging Het
Ezh2 A T 6: 47,554,191 D186E probably benign Het
Fam196b T C 11: 34,402,539 S194P probably benign Het
Gfra1 T C 19: 58,453,457 D14G possibly damaging Het
Gm9573 T C 17: 35,622,836 T153A unknown Het
Gmip C T 8: 69,817,733 R698W probably damaging Het
Grk4 A G 5: 34,694,816 N135D probably benign Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Htatip2 T G 7: 49,770,884 H159Q possibly damaging Het
Igfn1 T C 1: 135,969,036 E1264G probably benign Het
Katnb1 T A 8: 95,095,208 V223E possibly damaging Het
Klra6 AGG AG 6: 130,013,352 probably null Het
Masp2 C T 4: 148,602,747 R29C probably damaging Het
Mcm3 A T 1: 20,817,274 C123* probably null Het
Mdn1 T C 4: 32,718,420 V2225A probably damaging Het
Me1 A G 9: 86,679,900 L44S probably damaging Het
Mlxip A G 5: 123,445,514 N380S probably benign Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Myocd A T 11: 65,218,626 D106E probably damaging Het
Oat T C 7: 132,558,259 I411V probably benign Het
Olfr1085 A G 2: 86,658,029 V143A probably benign Het
Olfr483 T C 7: 108,103,648 V113A probably benign Het
Orc2 A T 1: 58,480,317 H246Q possibly damaging Het
Pank4 A G 4: 154,974,643 E411G probably damaging Het
Pcdhb15 A G 18: 37,475,163 N483D probably damaging Het
Pcdhb20 A G 18: 37,505,651 D410G probably damaging Het
Pdcl2 A G 5: 76,317,999 C125R probably damaging Het
Peli3 C G 19: 4,934,556 probably null Het
Pkd1 A G 17: 24,586,500 D3313G probably benign Het
Plec A C 15: 76,177,439 M2766R probably damaging Het
Ppargc1a C T 5: 51,498,162 V99M probably damaging Het
Psg19 G A 7: 18,792,443 A374V probably benign Het
Psmd7 A T 8: 107,586,629 F54L possibly damaging Het
Ptbp2 C T 3: 119,720,988 G397R probably null Het
Ranbp3 A G 17: 56,696,718 D39G probably damaging Het
Rcor3 T C 1: 192,101,721 T406A probably benign Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Rpia A T 6: 70,766,618 M283K probably damaging Het
Rps6kc1 T C 1: 190,871,825 D200G probably benign Het
Sipa1l1 A T 12: 82,342,497 K499M probably damaging Het
Slc5a4b A G 10: 76,070,573 L404P probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St7 A C 6: 17,854,999 T312P probably damaging Het
Strbp T C 2: 37,625,282 E244G probably damaging Het
Tbc1d8 T G 1: 39,376,980 T871P probably benign Het
Tcp1 T A 17: 12,922,162 I286N probably damaging Het
Tead3 C A 17: 28,333,517 V327F probably damaging Het
Tmem132c A T 5: 127,563,440 T892S probably benign Het
Trmt2a T C 16: 18,250,623 S65P probably benign Het
Ubp1 A G 9: 113,973,529 N479S possibly damaging Het
Ubtfl1 A T 9: 18,409,231 L18F possibly damaging Het
Uevld T G 7: 46,938,056 M299L probably benign Het
Unc13b T A 4: 43,173,854 Y1561N unknown Het
Ylpm1 A G 12: 85,029,122 K874E probably damaging Het
Zbtb37 G A 1: 161,032,232 R168W possibly damaging Het
Other mutations in Olfr715
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Olfr715 APN 7 107129065 nonsense probably null
IGL02238:Olfr715 APN 7 107129037 missense probably damaging 1.00
H8562:Olfr715 UTSW 7 107129241 missense probably benign 0.00
PIT4810001:Olfr715 UTSW 7 107128559 missense probably benign 0.11
R0440:Olfr715 UTSW 7 107128732 missense probably benign 0.03
R0592:Olfr715 UTSW 7 107129343 missense probably benign 0.02
R1051:Olfr715 UTSW 7 107128916 missense possibly damaging 0.94
R1959:Olfr715 UTSW 7 107128510 missense possibly damaging 0.76
R4237:Olfr715 UTSW 7 107129037 missense probably damaging 1.00
R4985:Olfr715 UTSW 7 107129027 missense probably damaging 1.00
R4994:Olfr715 UTSW 7 107129064 missense probably benign 0.03
R6376:Olfr715 UTSW 7 107128641 missense probably benign 0.39
R6931:Olfr715 UTSW 7 107128901 missense probably damaging 1.00
R7593:Olfr715 UTSW 7 107128575 missense probably damaging 1.00
Z1177:Olfr715 UTSW 7 107128884 missense probably damaging 1.00
Z1177:Olfr715 UTSW 7 107129100 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CATGGCTACTTTCCACAAAGCTC -3'
(R):5'- ATCGAGGCAGCAACAGTATTG -3'

Sequencing Primer
(F):5'- GGGATTAAGCATAGGTGTCACCATTG -3'
(R):5'- AACAGTATTGCTCACTTCTTTTGTG -3'
Posted On2019-11-12