Incidental Mutation 'R7718:Ubtfl1'
ID595052
Institutional Source Beutler Lab
Gene Symbol Ubtfl1
Ensembl Gene ENSMUSG00000074502
Gene Nameupstream binding transcription factor, RNA polymerase I-like 1
SynonymsHmgpi, B020006M18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R7718 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location18404418-18413177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18409231 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 18 (L18F)
Ref Sequence ENSEMBL: ENSMUSP00000129611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098973] [ENSMUST00000164441] [ENSMUST00000169398]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098973
AA Change: L18F

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096572
Gene: ENSMUSG00000074502
AA Change: L18F

DomainStartEndE-ValueType
Blast:SANT 6 64 1e-17 BLAST
HMG 100 170 5.61e-16 SMART
HMG 224 292 3.79e-4 SMART
low complexity region 297 307 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164441
AA Change: L18F

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129611
Gene: ENSMUSG00000074502
AA Change: L18F

DomainStartEndE-ValueType
Blast:SANT 6 64 1e-17 BLAST
HMG 100 170 5.61e-16 SMART
HMG 224 292 3.79e-4 SMART
low complexity region 297 307 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169398
AA Change: L18F

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126540
Gene: ENSMUSG00000074502
AA Change: L18F

DomainStartEndE-ValueType
Blast:SANT 6 64 1e-17 BLAST
HMG 100 170 5.61e-16 SMART
HMG 224 292 3.79e-4 SMART
low complexity region 297 307 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,147,201 F1106S probably damaging Het
A430033K04Rik A T 5: 138,647,860 H669L possibly damaging Het
A930017K11Rik T A 17: 25,947,024 R430* probably null Het
Abcb1a A T 5: 8,715,788 N700I probably damaging Het
Abcc6 T C 7: 45,977,392 K1414E possibly damaging Het
Adcy5 T C 16: 35,280,415 V779A probably benign Het
Agap2 A G 10: 127,079,865 S82G possibly damaging Het
Aldh1l1 A G 6: 90,598,323 N864S probably damaging Het
Ang2 A T 14: 51,195,760 V55E probably benign Het
Ank2 A G 3: 126,965,013 M179T possibly damaging Het
Atrnl1 T A 19: 57,740,183 C1090* probably null Het
Atxn1l A G 8: 109,733,234 L132P probably damaging Het
Bptf A G 11: 107,081,456 V862A possibly damaging Het
Capn11 C A 17: 45,643,781 K143N probably damaging Het
Card6 A G 15: 5,099,787 V709A possibly damaging Het
Cavin4 C T 4: 48,671,984 A143V probably benign Het
Cntn5 A G 9: 9,984,128 I160T probably benign Het
Cyp2c40 T A 19: 39,767,338 N511Y probably benign Het
Dsc2 A T 18: 20,041,778 I480N probably damaging Het
Enoph1 T C 5: 100,062,160 V133A possibly damaging Het
Ezh2 A T 6: 47,554,191 D186E probably benign Het
Fam196b T C 11: 34,402,539 S194P probably benign Het
Gfra1 T C 19: 58,453,457 D14G possibly damaging Het
Gm9573 T C 17: 35,622,836 T153A unknown Het
Gmip C T 8: 69,817,733 R698W probably damaging Het
Grk4 A G 5: 34,694,816 N135D probably benign Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Htatip2 T G 7: 49,770,884 H159Q possibly damaging Het
Igfn1 T C 1: 135,969,036 E1264G probably benign Het
Katnb1 T A 8: 95,095,208 V223E possibly damaging Het
Klra6 AGG AG 6: 130,013,352 probably null Het
Masp2 C T 4: 148,602,747 R29C probably damaging Het
Mcm3 A T 1: 20,817,274 C123* probably null Het
Mdn1 T C 4: 32,718,420 V2225A probably damaging Het
Me1 A G 9: 86,679,900 L44S probably damaging Het
Mlxip A G 5: 123,445,514 N380S probably benign Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Myocd A T 11: 65,218,626 D106E probably damaging Het
Oat T C 7: 132,558,259 I411V probably benign Het
Olfr1085 A G 2: 86,658,029 V143A probably benign Het
Olfr483 T C 7: 108,103,648 V113A probably benign Het
Olfr715 A T 7: 107,128,718 V225D probably damaging Het
Orc2 A T 1: 58,480,317 H246Q possibly damaging Het
Pank4 A G 4: 154,974,643 E411G probably damaging Het
Pcdhb15 A G 18: 37,475,163 N483D probably damaging Het
Pcdhb20 A G 18: 37,505,651 D410G probably damaging Het
Pdcl2 A G 5: 76,317,999 C125R probably damaging Het
Peli3 C G 19: 4,934,556 probably null Het
Pkd1 A G 17: 24,586,500 D3313G probably benign Het
Plec A C 15: 76,177,439 M2766R probably damaging Het
Ppargc1a C T 5: 51,498,162 V99M probably damaging Het
Psg19 G A 7: 18,792,443 A374V probably benign Het
Psmd7 A T 8: 107,586,629 F54L possibly damaging Het
Ptbp2 C T 3: 119,720,988 G397R probably null Het
Ranbp3 A G 17: 56,696,718 D39G probably damaging Het
Rcor3 T C 1: 192,101,721 T406A probably benign Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Rpia A T 6: 70,766,618 M283K probably damaging Het
Rps6kc1 T C 1: 190,871,825 D200G probably benign Het
Sipa1l1 A T 12: 82,342,497 K499M probably damaging Het
Slc5a4b A G 10: 76,070,573 L404P probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St7 A C 6: 17,854,999 T312P probably damaging Het
Strbp T C 2: 37,625,282 E244G probably damaging Het
Tbc1d8 T G 1: 39,376,980 T871P probably benign Het
Tcp1 T A 17: 12,922,162 I286N probably damaging Het
Tead3 C A 17: 28,333,517 V327F probably damaging Het
Tmem132c A T 5: 127,563,440 T892S probably benign Het
Trmt2a T C 16: 18,250,623 S65P probably benign Het
Ubp1 A G 9: 113,973,529 N479S possibly damaging Het
Uevld T G 7: 46,938,056 M299L probably benign Het
Unc13b T A 4: 43,173,854 Y1561N unknown Het
Ylpm1 A G 12: 85,029,122 K874E probably damaging Het
Zbtb37 G A 1: 161,032,232 R168W possibly damaging Het
Other mutations in Ubtfl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Ubtfl1 APN 9 18409721 missense possibly damaging 0.93
IGL02028:Ubtfl1 APN 9 18409553 missense possibly damaging 0.83
R0112:Ubtfl1 UTSW 9 18409787 missense probably benign 0.24
R0600:Ubtfl1 UTSW 9 18409364 missense probably damaging 1.00
R1450:Ubtfl1 UTSW 9 18409913 missense possibly damaging 0.54
R1511:Ubtfl1 UTSW 9 18410193 missense probably benign 0.00
R2007:Ubtfl1 UTSW 9 18409251 missense possibly damaging 0.93
R3611:Ubtfl1 UTSW 9 18409365 missense probably damaging 1.00
R3836:Ubtfl1 UTSW 9 18409237 missense possibly damaging 0.67
R4088:Ubtfl1 UTSW 9 18409968 missense probably damaging 0.98
R4577:Ubtfl1 UTSW 9 18409493 missense probably damaging 1.00
R5057:Ubtfl1 UTSW 9 18409191 missense possibly damaging 0.83
R5224:Ubtfl1 UTSW 9 18410030 missense probably benign 0.34
R5284:Ubtfl1 UTSW 9 18409445 nonsense probably null
R5965:Ubtfl1 UTSW 9 18409542 missense probably benign 0.04
R6261:Ubtfl1 UTSW 9 18409296 missense possibly damaging 0.65
R6449:Ubtfl1 UTSW 9 18409629 missense possibly damaging 0.88
R6951:Ubtfl1 UTSW 9 18409577 missense probably benign 0.03
R7130:Ubtfl1 UTSW 9 18409847 missense probably damaging 1.00
R7133:Ubtfl1 UTSW 9 18409635 missense probably damaging 1.00
R7664:Ubtfl1 UTSW 9 18409486 missense possibly damaging 0.66
Z1177:Ubtfl1 UTSW 9 18409667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATTATCCACTTATACTGTCAATAG -3'
(R):5'- TCAGTGTGCGGAACTTCC -3'

Sequencing Primer
(F):5'- TACAGATGGTTGTGAGCCACC -3'
(R):5'- TGTGCGGAACTTCCTTAAATTATAAG -3'
Posted On2019-11-12