Incidental Mutation 'R7718:Ubp1'
ID595054
Institutional Source Beutler Lab
Gene Symbol Ubp1
Ensembl Gene ENSMUSG00000009741
Gene Nameupstream binding protein 1
SynonymsNF2d9, LBP-1b, LBP-1a
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7718 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location113930934-113977202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113973529 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 479 (N479S)
Ref Sequence ENSEMBL: ENSMUSP00000149908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009885] [ENSMUST00000035090] [ENSMUST00000084885] [ENSMUST00000116492] [ENSMUST00000117537] [ENSMUST00000143180] [ENSMUST00000214095] [ENSMUST00000216558]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009885
AA Change: N479S

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000009885
Gene: ENSMUSG00000009741
AA Change: N479S

DomainStartEndE-ValueType
Pfam:CP2 37 259 1.6e-76 PFAM
SCOP:d1kw4a_ 333 381 5e-3 SMART
low complexity region 409 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035090
SMART Domains Protein: ENSMUSP00000035090
Gene: ENSMUSG00000032507

DomainStartEndE-ValueType
FBOX 15 55 1.18e-6 SMART
LRR 77 102 1.16e-1 SMART
LRR 103 128 5.21e-4 SMART
LRR 129 154 2.24e-3 SMART
LRR_CC 155 180 5.46e-7 SMART
LRR 181 206 7.05e-1 SMART
LRR 207 232 4.87e-4 SMART
LRR 233 258 1.5e-4 SMART
LRR 259 284 8.81e-2 SMART
LRR 285 310 2.05e-2 SMART
LRR_CC 311 336 6.37e-8 SMART
LRR 365 391 2.44e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000084885
AA Change: N515S

PolyPhen 2 Score 0.735 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081946
Gene: ENSMUSG00000009741
AA Change: N515S

DomainStartEndE-ValueType
Pfam:CP2 42 257 3e-62 PFAM
SCOP:d1kw4a_ 369 417 6e-3 SMART
low complexity region 445 463 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000116492
AA Change: N479S

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112192
Gene: ENSMUSG00000009741
AA Change: N479S

DomainStartEndE-ValueType
Pfam:CP2 37 259 1.6e-76 PFAM
SCOP:d1kw4a_ 333 381 5e-3 SMART
low complexity region 409 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117537
SMART Domains Protein: ENSMUSP00000114075
Gene: ENSMUSG00000032507

DomainStartEndE-ValueType
FBOX 15 55 1.18e-6 SMART
LRR 77 102 1.16e-1 SMART
LRR 103 128 5.21e-4 SMART
LRR 129 154 2.24e-3 SMART
LRR_CC 155 180 5.46e-7 SMART
LRR 181 206 7.05e-1 SMART
LRR 207 232 4.87e-4 SMART
LRR 233 258 1.5e-4 SMART
LRR 259 284 8.81e-2 SMART
LRR 285 310 2.05e-2 SMART
LRR_CC 311 336 6.37e-8 SMART
LRR 365 391 2.44e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143180
Predicted Effect possibly damaging
Transcript: ENSMUST00000214095
AA Change: N479S

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216558
AA Change: N515S

PolyPhen 2 Score 0.735 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene die during gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,147,201 F1106S probably damaging Het
A430033K04Rik A T 5: 138,647,860 H669L possibly damaging Het
A930017K11Rik T A 17: 25,947,024 R430* probably null Het
Abcb1a A T 5: 8,715,788 N700I probably damaging Het
Abcc6 T C 7: 45,977,392 K1414E possibly damaging Het
Adcy5 T C 16: 35,280,415 V779A probably benign Het
Agap2 A G 10: 127,079,865 S82G possibly damaging Het
Aldh1l1 A G 6: 90,598,323 N864S probably damaging Het
Ang2 A T 14: 51,195,760 V55E probably benign Het
Ank2 A G 3: 126,965,013 M179T possibly damaging Het
Atrnl1 T A 19: 57,740,183 C1090* probably null Het
Atxn1l A G 8: 109,733,234 L132P probably damaging Het
Bptf A G 11: 107,081,456 V862A possibly damaging Het
Capn11 C A 17: 45,643,781 K143N probably damaging Het
Card6 A G 15: 5,099,787 V709A possibly damaging Het
Cavin4 C T 4: 48,671,984 A143V probably benign Het
Cntn5 A G 9: 9,984,128 I160T probably benign Het
Cyp2c40 T A 19: 39,767,338 N511Y probably benign Het
Dsc2 A T 18: 20,041,778 I480N probably damaging Het
Enoph1 T C 5: 100,062,160 V133A possibly damaging Het
Ezh2 A T 6: 47,554,191 D186E probably benign Het
Fam196b T C 11: 34,402,539 S194P probably benign Het
Gfra1 T C 19: 58,453,457 D14G possibly damaging Het
Gm9573 T C 17: 35,622,836 T153A unknown Het
Gmip C T 8: 69,817,733 R698W probably damaging Het
Grk4 A G 5: 34,694,816 N135D probably benign Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Htatip2 T G 7: 49,770,884 H159Q possibly damaging Het
Igfn1 T C 1: 135,969,036 E1264G probably benign Het
Katnb1 T A 8: 95,095,208 V223E possibly damaging Het
Klra6 AGG AG 6: 130,013,352 probably null Het
Masp2 C T 4: 148,602,747 R29C probably damaging Het
Mcm3 A T 1: 20,817,274 C123* probably null Het
Mdn1 T C 4: 32,718,420 V2225A probably damaging Het
Me1 A G 9: 86,679,900 L44S probably damaging Het
Mlxip A G 5: 123,445,514 N380S probably benign Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Myocd A T 11: 65,218,626 D106E probably damaging Het
Oat T C 7: 132,558,259 I411V probably benign Het
Olfr1085 A G 2: 86,658,029 V143A probably benign Het
Olfr483 T C 7: 108,103,648 V113A probably benign Het
Olfr715 A T 7: 107,128,718 V225D probably damaging Het
Orc2 A T 1: 58,480,317 H246Q possibly damaging Het
Pank4 A G 4: 154,974,643 E411G probably damaging Het
Pcdhb15 A G 18: 37,475,163 N483D probably damaging Het
Pcdhb20 A G 18: 37,505,651 D410G probably damaging Het
Pdcl2 A G 5: 76,317,999 C125R probably damaging Het
Peli3 C G 19: 4,934,556 probably null Het
Pkd1 A G 17: 24,586,500 D3313G probably benign Het
Plec A C 15: 76,177,439 M2766R probably damaging Het
Ppargc1a C T 5: 51,498,162 V99M probably damaging Het
Psg19 G A 7: 18,792,443 A374V probably benign Het
Psmd7 A T 8: 107,586,629 F54L possibly damaging Het
Ptbp2 C T 3: 119,720,988 G397R probably null Het
Ranbp3 A G 17: 56,696,718 D39G probably damaging Het
Rcor3 T C 1: 192,101,721 T406A probably benign Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Rpia A T 6: 70,766,618 M283K probably damaging Het
Rps6kc1 T C 1: 190,871,825 D200G probably benign Het
Sipa1l1 A T 12: 82,342,497 K499M probably damaging Het
Slc5a4b A G 10: 76,070,573 L404P probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St7 A C 6: 17,854,999 T312P probably damaging Het
Strbp T C 2: 37,625,282 E244G probably damaging Het
Tbc1d8 T G 1: 39,376,980 T871P probably benign Het
Tcp1 T A 17: 12,922,162 I286N probably damaging Het
Tead3 C A 17: 28,333,517 V327F probably damaging Het
Tmem132c A T 5: 127,563,440 T892S probably benign Het
Trmt2a T C 16: 18,250,623 S65P probably benign Het
Ubtfl1 A T 9: 18,409,231 L18F possibly damaging Het
Uevld T G 7: 46,938,056 M299L probably benign Het
Unc13b T A 4: 43,173,854 Y1561N unknown Het
Ylpm1 A G 12: 85,029,122 K874E probably damaging Het
Zbtb37 G A 1: 161,032,232 R168W possibly damaging Het
Other mutations in Ubp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Ubp1 APN 9 113956758 missense probably damaging 1.00
IGL01951:Ubp1 APN 9 113951618 nonsense probably null
R0097:Ubp1 UTSW 9 113973507 splice site probably benign
R0097:Ubp1 UTSW 9 113973507 splice site probably benign
R0241:Ubp1 UTSW 9 113966587 critical splice donor site probably null
R0669:Ubp1 UTSW 9 113964668 splice site probably benign
R0709:Ubp1 UTSW 9 113944931 missense probably damaging 1.00
R1416:Ubp1 UTSW 9 113970171 missense probably benign 0.02
R1466:Ubp1 UTSW 9 113944835 splice site probably benign
R1753:Ubp1 UTSW 9 113955969 missense possibly damaging 0.74
R1780:Ubp1 UTSW 9 113964579 missense possibly damaging 0.84
R2235:Ubp1 UTSW 9 113964644 missense probably damaging 1.00
R3418:Ubp1 UTSW 9 113951686 critical splice donor site probably null
R3978:Ubp1 UTSW 9 113956705 critical splice acceptor site probably null
R4024:Ubp1 UTSW 9 113944883 missense probably benign 0.03
R4469:Ubp1 UTSW 9 113958707 missense probably benign 0.11
R4797:Ubp1 UTSW 9 113956002 missense probably damaging 1.00
R4984:Ubp1 UTSW 9 113959392 missense probably damaging 0.97
R5914:Ubp1 UTSW 9 113956739 missense probably benign 0.00
R6971:Ubp1 UTSW 9 113972763 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTCATACTGCTGTCCATCAGG -3'
(R):5'- AACACTGGGTGAATAGACTCTG -3'

Sequencing Primer
(F):5'- TCCATCAGGAATGATTAGGGTTG -3'
(R):5'- ACACTGGGTGAATAGACTCTGTTTGG -3'
Posted On2019-11-12