Incidental Mutation 'R7718:Myocd'
ID595058
Institutional Source Beutler Lab
Gene Symbol Myocd
Ensembl Gene ENSMUSG00000020542
Gene Namemyocardin
SynonymsSrfcp
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7718 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location65176561-65269989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65218626 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 106 (D106E)
Ref Sequence ENSEMBL: ENSMUSP00000104335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101042] [ENSMUST00000102635] [ENSMUST00000108695]
Predicted Effect probably benign
Transcript: ENSMUST00000101042
SMART Domains Protein: ENSMUSP00000098603
Gene: ENSMUSG00000020542

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
SCOP:d1lsha3 140 221 4e-3 SMART
SAP 252 286 1.29e-8 SMART
low complexity region 326 343 N/A INTRINSIC
low complexity region 371 383 N/A INTRINSIC
coiled coil region 396 435 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102635
AA Change: D106E

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099695
Gene: ENSMUSG00000020542
AA Change: D106E

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 4e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 695 709 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108695
AA Change: D106E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104335
Gene: ENSMUSG00000020542
AA Change: D106E

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 5e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 685 701 N/A INTRINSIC
low complexity region 743 757 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which is expressed in heart, aorta, and in smooth muscle cell-containing tissues. It functions as a transcriptional co-activator of serum response factor (SRF) and modulates expression of cardiac and smooth muscle-specific SRF-target genes, and thus may play a crucial role in cardiogenesis and differentiation of the smooth muscle cell lineage. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null mutation exhibit embryonic lethality and fail to form vascular smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,147,201 F1106S probably damaging Het
A430033K04Rik A T 5: 138,647,860 H669L possibly damaging Het
A930017K11Rik T A 17: 25,947,024 R430* probably null Het
Abcb1a A T 5: 8,715,788 N700I probably damaging Het
Abcc6 T C 7: 45,977,392 K1414E possibly damaging Het
Adcy5 T C 16: 35,280,415 V779A probably benign Het
Agap2 A G 10: 127,079,865 S82G possibly damaging Het
Aldh1l1 A G 6: 90,598,323 N864S probably damaging Het
Ang2 A T 14: 51,195,760 V55E probably benign Het
Ank2 A G 3: 126,965,013 M179T possibly damaging Het
Atrnl1 T A 19: 57,740,183 C1090* probably null Het
Atxn1l A G 8: 109,733,234 L132P probably damaging Het
Bptf A G 11: 107,081,456 V862A possibly damaging Het
Capn11 C A 17: 45,643,781 K143N probably damaging Het
Card6 A G 15: 5,099,787 V709A possibly damaging Het
Cavin4 C T 4: 48,671,984 A143V probably benign Het
Cntn5 A G 9: 9,984,128 I160T probably benign Het
Cyp2c40 T A 19: 39,767,338 N511Y probably benign Het
Dsc2 A T 18: 20,041,778 I480N probably damaging Het
Enoph1 T C 5: 100,062,160 V133A possibly damaging Het
Ezh2 A T 6: 47,554,191 D186E probably benign Het
Fam196b T C 11: 34,402,539 S194P probably benign Het
Gfra1 T C 19: 58,453,457 D14G possibly damaging Het
Gm9573 T C 17: 35,622,836 T153A unknown Het
Gmip C T 8: 69,817,733 R698W probably damaging Het
Grk4 A G 5: 34,694,816 N135D probably benign Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Htatip2 T G 7: 49,770,884 H159Q possibly damaging Het
Igfn1 T C 1: 135,969,036 E1264G probably benign Het
Katnb1 T A 8: 95,095,208 V223E possibly damaging Het
Klra6 AGG AG 6: 130,013,352 probably null Het
Masp2 C T 4: 148,602,747 R29C probably damaging Het
Mcm3 A T 1: 20,817,274 C123* probably null Het
Mdn1 T C 4: 32,718,420 V2225A probably damaging Het
Me1 A G 9: 86,679,900 L44S probably damaging Het
Mlxip A G 5: 123,445,514 N380S probably benign Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Oat T C 7: 132,558,259 I411V probably benign Het
Olfr1085 A G 2: 86,658,029 V143A probably benign Het
Olfr483 T C 7: 108,103,648 V113A probably benign Het
Olfr715 A T 7: 107,128,718 V225D probably damaging Het
Orc2 A T 1: 58,480,317 H246Q possibly damaging Het
Pank4 A G 4: 154,974,643 E411G probably damaging Het
Pcdhb15 A G 18: 37,475,163 N483D probably damaging Het
Pcdhb20 A G 18: 37,505,651 D410G probably damaging Het
Pdcl2 A G 5: 76,317,999 C125R probably damaging Het
Peli3 C G 19: 4,934,556 probably null Het
Pkd1 A G 17: 24,586,500 D3313G probably benign Het
Plec A C 15: 76,177,439 M2766R probably damaging Het
Ppargc1a C T 5: 51,498,162 V99M probably damaging Het
Psg19 G A 7: 18,792,443 A374V probably benign Het
Psmd7 A T 8: 107,586,629 F54L possibly damaging Het
Ptbp2 C T 3: 119,720,988 G397R probably null Het
Ranbp3 A G 17: 56,696,718 D39G probably damaging Het
Rcor3 T C 1: 192,101,721 T406A probably benign Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Rpia A T 6: 70,766,618 M283K probably damaging Het
Rps6kc1 T C 1: 190,871,825 D200G probably benign Het
Sipa1l1 A T 12: 82,342,497 K499M probably damaging Het
Slc5a4b A G 10: 76,070,573 L404P probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St7 A C 6: 17,854,999 T312P probably damaging Het
Strbp T C 2: 37,625,282 E244G probably damaging Het
Tbc1d8 T G 1: 39,376,980 T871P probably benign Het
Tcp1 T A 17: 12,922,162 I286N probably damaging Het
Tead3 C A 17: 28,333,517 V327F probably damaging Het
Tmem132c A T 5: 127,563,440 T892S probably benign Het
Trmt2a T C 16: 18,250,623 S65P probably benign Het
Ubp1 A G 9: 113,973,529 N479S possibly damaging Het
Ubtfl1 A T 9: 18,409,231 L18F possibly damaging Het
Uevld T G 7: 46,938,056 M299L probably benign Het
Unc13b T A 4: 43,173,854 Y1561N unknown Het
Ylpm1 A G 12: 85,029,122 K874E probably damaging Het
Zbtb37 G A 1: 161,032,232 R168W possibly damaging Het
Other mutations in Myocd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Myocd APN 11 65180944 critical splice acceptor site probably null
IGL00481:Myocd APN 11 65187154 missense probably damaging 0.99
IGL00857:Myocd APN 11 65178836 missense possibly damaging 0.93
IGL01012:Myocd APN 11 65184625 missense possibly damaging 0.51
IGL01570:Myocd APN 11 65200807 missense probably benign 0.00
IGL01865:Myocd APN 11 65200897 missense probably benign 0.30
IGL01938:Myocd APN 11 65187088 missense probably damaging 1.00
IGL02324:Myocd APN 11 65178658 missense probably benign 0.01
IGL02598:Myocd APN 11 65183470 missense probably benign 0.31
IGL02886:Myocd APN 11 65178743 missense probably damaging 0.99
IGL03008:Myocd APN 11 65187566 missense probably damaging 0.98
IGL03034:Myocd APN 11 65218685 missense probably benign 0.00
harvey UTSW 11 65179030 splice site probably null
irma UTSW 11 65196394 missense probably damaging 0.97
Nate UTSW 11 65233088 intron probably null
R0078:Myocd UTSW 11 65187464 missense possibly damaging 0.96
R0097:Myocd UTSW 11 65179014 missense possibly damaging 0.67
R0097:Myocd UTSW 11 65179014 missense possibly damaging 0.67
R0234:Myocd UTSW 11 65187240 missense probably benign 0.01
R0234:Myocd UTSW 11 65187240 missense probably benign 0.01
R0453:Myocd UTSW 11 65196225 missense probably damaging 1.00
R0523:Myocd UTSW 11 65180902 missense probably damaging 1.00
R0838:Myocd UTSW 11 65178932 missense probably benign 0.00
R0899:Myocd UTSW 11 65195192 missense possibly damaging 0.50
R1167:Myocd UTSW 11 65196377 missense possibly damaging 0.77
R1472:Myocd UTSW 11 65187504 missense probably benign 0.01
R1508:Myocd UTSW 11 65184516 missense probably damaging 0.98
R1620:Myocd UTSW 11 65196394 missense probably damaging 0.97
R1630:Myocd UTSW 11 65196394 missense probably damaging 0.97
R1731:Myocd UTSW 11 65200888 missense probably benign 0.30
R1740:Myocd UTSW 11 65218521 splice site probably benign
R1769:Myocd UTSW 11 65178701 missense probably benign 0.01
R1823:Myocd UTSW 11 65178670 missense probably benign 0.00
R1968:Myocd UTSW 11 65200907 missense probably damaging 1.00
R1997:Myocd UTSW 11 65204321 nonsense probably null
R2018:Myocd UTSW 11 65187028 missense probably damaging 1.00
R2105:Myocd UTSW 11 65218658 nonsense probably null
R2314:Myocd UTSW 11 65200807 missense probably damaging 1.00
R4330:Myocd UTSW 11 65223764 missense probably benign 0.12
R4331:Myocd UTSW 11 65223764 missense probably benign 0.12
R4603:Myocd UTSW 11 65187745 missense possibly damaging 0.82
R4619:Myocd UTSW 11 65178428 utr 3 prime probably benign
R4631:Myocd UTSW 11 65178859 missense probably benign 0.10
R4865:Myocd UTSW 11 65179030 splice site probably null
R4974:Myocd UTSW 11 65183473 missense possibly damaging 0.78
R4976:Myocd UTSW 11 65222050 missense probably benign 0.00
R5478:Myocd UTSW 11 65233088 intron probably null
R5499:Myocd UTSW 11 65178749 missense possibly damaging 0.62
R6052:Myocd UTSW 11 65196256 missense probably damaging 1.00
R6356:Myocd UTSW 11 65218570 unclassified probably null
R7144:Myocd UTSW 11 65218648 missense probably damaging 1.00
R7261:Myocd UTSW 11 65187596 missense probably damaging 0.98
R7354:Myocd UTSW 11 65187493 missense probably benign 0.00
R7461:Myocd UTSW 11 65218603 missense probably damaging 1.00
R7613:Myocd UTSW 11 65218603 missense probably damaging 1.00
X0057:Myocd UTSW 11 65183445 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGAACAAAATCCCTGGATTGCC -3'
(R):5'- CCTGTGAAGTGATGATGCTCAC -3'

Sequencing Primer
(F):5'- TGGATTGCCAGAGCTGC -3'
(R):5'- TTATCAAAATGGTAGAGCGTGGTG -3'
Posted On2019-11-12