Incidental Mutation 'R7718:Trmt2a'
ID595065
Institutional Source Beutler Lab
Gene Symbol Trmt2a
Ensembl Gene ENSMUSG00000022721
Gene NameTRM2 tRNA methyltransferase 2A
SynonymsHtf9c
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7718 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location18248679-18254772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18250623 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 65 (S65P)
Ref Sequence ENSEMBL: ENSMUSP00000156227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009321] [ENSMUST00000052325] [ENSMUST00000100099] [ENSMUST00000115640] [ENSMUST00000115645] [ENSMUST00000128045] [ENSMUST00000140206] [ENSMUST00000231509]
Predicted Effect probably benign
Transcript: ENSMUST00000009321
SMART Domains Protein: ENSMUSP00000009321
Gene: ENSMUSG00000022718

DomainStartEndE-ValueType
low complexity region 165 176 N/A INTRINSIC
WW 302 334 7.26e-6 SMART
low complexity region 411 421 N/A INTRINSIC
DSRM 512 577 5.68e-10 SMART
DSRM 620 685 8.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052325
SMART Domains Protein: ENSMUSP00000055288
Gene: ENSMUSG00000005732

DomainStartEndE-ValueType
RanBD 1 108 4.92e-46 SMART
coiled coil region 123 153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100099
SMART Domains Protein: ENSMUSP00000111303
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 1.2e-20 PFAM
Pfam:PCMT 386 482 1.1e-8 PFAM
Pfam:MTS 389 489 6.2e-9 PFAM
Pfam:Methyltransf_4 397 497 4.2e-7 PFAM
Pfam:Methyltransf_31 420 546 6.2e-15 PFAM
Pfam:Methyltransf_18 422 523 9.3e-11 PFAM
Pfam:Methyltransf_26 423 538 5.3e-12 PFAM
Pfam:Methyltransf_25 426 511 3.5e-8 PFAM
Pfam:Methyltransf_11 427 487 5.6e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115640
SMART Domains Protein: ENSMUSP00000111304
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 2.6e-20 PFAM
Pfam:PCMT 386 482 3.4e-9 PFAM
Pfam:MTS 392 489 1e-7 PFAM
Pfam:Cons_hypoth95 405 542 2.7e-7 PFAM
Pfam:Methyltransf_31 420 547 2.1e-15 PFAM
Pfam:Methyltransf_18 422 526 2.9e-12 PFAM
Pfam:Methyltransf_4 423 499 2.6e-7 PFAM
Pfam:Methyltransf_25 426 511 1.3e-8 PFAM
Pfam:Methyltransf_11 427 489 3.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115645
SMART Domains Protein: ENSMUSP00000111309
Gene: ENSMUSG00000005732

DomainStartEndE-ValueType
RanBD 27 158 3.33e-75 SMART
low complexity region 183 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128045
Predicted Effect probably benign
Transcript: ENSMUST00000140206
SMART Domains Protein: ENSMUSP00000121216
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 383 481 3.7e-8 PFAM
Pfam:PCMT 386 481 1.5e-6 PFAM
Pfam:MTS 389 493 2.5e-7 PFAM
Pfam:Methyltransf_31 420 491 1.5e-9 PFAM
Pfam:Methyltransf_18 422 508 4.1e-8 PFAM
Pfam:Methyltransf_26 423 523 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145112
SMART Domains Protein: ENSMUSP00000117026
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
Pfam:PCMT 118 220 4.2e-7 PFAM
Pfam:tRNA_U5-meth_tr 118 280 4e-16 PFAM
Pfam:MTS 129 229 5.4e-6 PFAM
Pfam:Cons_hypoth95 143 277 6.5e-5 PFAM
Pfam:PrmA 146 234 2e-4 PFAM
Pfam:Ubie_methyltran 148 223 1e-4 PFAM
Pfam:Methyltransf_31 158 271 6.1e-14 PFAM
Pfam:Methyltransf_18 160 263 8.3e-11 PFAM
Pfam:Methyltransf_4 161 237 7.1e-5 PFAM
Pfam:Methyltransf_26 161 274 2e-6 PFAM
Pfam:Methyltransf_25 164 251 5.2e-7 PFAM
Pfam:Methyltransf_11 165 227 9.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231509
AA Change: S65P

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000232144
Predicted Effect probably benign
Transcript: ENSMUST00000232293
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is of unknown function. However, it is orthologous to the mouse Trmt2a gene and contains an RNA methyltransferase domain. Expression of this gene varies during the cell cycle, with aberrant expression being a possible biomarker in certain breast cancers. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,147,201 F1106S probably damaging Het
A430033K04Rik A T 5: 138,647,860 H669L possibly damaging Het
A930017K11Rik T A 17: 25,947,024 R430* probably null Het
Abcb1a A T 5: 8,715,788 N700I probably damaging Het
Abcc6 T C 7: 45,977,392 K1414E possibly damaging Het
Adcy5 T C 16: 35,280,415 V779A probably benign Het
Agap2 A G 10: 127,079,865 S82G possibly damaging Het
Aldh1l1 A G 6: 90,598,323 N864S probably damaging Het
Ang2 A T 14: 51,195,760 V55E probably benign Het
Ank2 A G 3: 126,965,013 M179T possibly damaging Het
Atrnl1 T A 19: 57,740,183 C1090* probably null Het
Atxn1l A G 8: 109,733,234 L132P probably damaging Het
Bptf A G 11: 107,081,456 V862A possibly damaging Het
Capn11 C A 17: 45,643,781 K143N probably damaging Het
Card6 A G 15: 5,099,787 V709A possibly damaging Het
Cavin4 C T 4: 48,671,984 A143V probably benign Het
Cntn5 A G 9: 9,984,128 I160T probably benign Het
Cyp2c40 T A 19: 39,767,338 N511Y probably benign Het
Dsc2 A T 18: 20,041,778 I480N probably damaging Het
Enoph1 T C 5: 100,062,160 V133A possibly damaging Het
Ezh2 A T 6: 47,554,191 D186E probably benign Het
Fam196b T C 11: 34,402,539 S194P probably benign Het
Gfra1 T C 19: 58,453,457 D14G possibly damaging Het
Gm9573 T C 17: 35,622,836 T153A unknown Het
Gmip C T 8: 69,817,733 R698W probably damaging Het
Grk4 A G 5: 34,694,816 N135D probably benign Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Htatip2 T G 7: 49,770,884 H159Q possibly damaging Het
Igfn1 T C 1: 135,969,036 E1264G probably benign Het
Katnb1 T A 8: 95,095,208 V223E possibly damaging Het
Klra6 AGG AG 6: 130,013,352 probably null Het
Masp2 C T 4: 148,602,747 R29C probably damaging Het
Mcm3 A T 1: 20,817,274 C123* probably null Het
Mdn1 T C 4: 32,718,420 V2225A probably damaging Het
Me1 A G 9: 86,679,900 L44S probably damaging Het
Mlxip A G 5: 123,445,514 N380S probably benign Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Myocd A T 11: 65,218,626 D106E probably damaging Het
Oat T C 7: 132,558,259 I411V probably benign Het
Olfr1085 A G 2: 86,658,029 V143A probably benign Het
Olfr483 T C 7: 108,103,648 V113A probably benign Het
Olfr715 A T 7: 107,128,718 V225D probably damaging Het
Orc2 A T 1: 58,480,317 H246Q possibly damaging Het
Pank4 A G 4: 154,974,643 E411G probably damaging Het
Pcdhb15 A G 18: 37,475,163 N483D probably damaging Het
Pcdhb20 A G 18: 37,505,651 D410G probably damaging Het
Pdcl2 A G 5: 76,317,999 C125R probably damaging Het
Peli3 C G 19: 4,934,556 probably null Het
Pkd1 A G 17: 24,586,500 D3313G probably benign Het
Plec A C 15: 76,177,439 M2766R probably damaging Het
Ppargc1a C T 5: 51,498,162 V99M probably damaging Het
Psg19 G A 7: 18,792,443 A374V probably benign Het
Psmd7 A T 8: 107,586,629 F54L possibly damaging Het
Ptbp2 C T 3: 119,720,988 G397R probably null Het
Ranbp3 A G 17: 56,696,718 D39G probably damaging Het
Rcor3 T C 1: 192,101,721 T406A probably benign Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Rpia A T 6: 70,766,618 M283K probably damaging Het
Rps6kc1 T C 1: 190,871,825 D200G probably benign Het
Sipa1l1 A T 12: 82,342,497 K499M probably damaging Het
Slc5a4b A G 10: 76,070,573 L404P probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St7 A C 6: 17,854,999 T312P probably damaging Het
Strbp T C 2: 37,625,282 E244G probably damaging Het
Tbc1d8 T G 1: 39,376,980 T871P probably benign Het
Tcp1 T A 17: 12,922,162 I286N probably damaging Het
Tead3 C A 17: 28,333,517 V327F probably damaging Het
Tmem132c A T 5: 127,563,440 T892S probably benign Het
Ubp1 A G 9: 113,973,529 N479S possibly damaging Het
Ubtfl1 A T 9: 18,409,231 L18F possibly damaging Het
Uevld T G 7: 46,938,056 M299L probably benign Het
Unc13b T A 4: 43,173,854 Y1561N unknown Het
Ylpm1 A G 12: 85,029,122 K874E probably damaging Het
Zbtb37 G A 1: 161,032,232 R168W possibly damaging Het
Other mutations in Trmt2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Trmt2a APN 16 18249487 missense probably benign
R0050:Trmt2a UTSW 16 18250843 missense probably damaging 1.00
R0050:Trmt2a UTSW 16 18250843 missense probably damaging 1.00
R0377:Trmt2a UTSW 16 18249703 missense possibly damaging 0.68
R0699:Trmt2a UTSW 16 18249529 missense probably benign 0.01
R1034:Trmt2a UTSW 16 18249709 missense probably damaging 1.00
R1114:Trmt2a UTSW 16 18250440 unclassified probably benign
R1882:Trmt2a UTSW 16 18249894 missense possibly damaging 0.88
R1911:Trmt2a UTSW 16 18251206 missense probably benign 0.01
R2184:Trmt2a UTSW 16 18252995 missense probably benign 0.06
R3853:Trmt2a UTSW 16 18251191 missense possibly damaging 0.94
R4427:Trmt2a UTSW 16 18249229 unclassified probably benign
R4737:Trmt2a UTSW 16 18251286 unclassified probably benign
R4896:Trmt2a UTSW 16 18252929 missense probably damaging 0.99
R4903:Trmt2a UTSW 16 18249554 nonsense probably null
R4964:Trmt2a UTSW 16 18249554 nonsense probably null
R4966:Trmt2a UTSW 16 18249554 nonsense probably null
R5216:Trmt2a UTSW 16 18252184 missense probably benign 0.22
R5452:Trmt2a UTSW 16 18250950 missense probably damaging 1.00
R5837:Trmt2a UTSW 16 18249462 unclassified probably benign
R6555:Trmt2a UTSW 16 18253203 missense probably benign 0.03
R6670:Trmt2a UTSW 16 18250477 missense possibly damaging 0.57
R7064:Trmt2a UTSW 16 18253004 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGCCCAGTATGGATGGGG -3'
(R):5'- GATCTCAACCTTGATTACCCAGCAC -3'

Sequencing Primer
(F):5'- TTCATCCTGCAGAGAAATTGGG -3'
(R):5'- CACTGGAAGAAGAAATACCATAGTG -3'
Posted On2019-11-12