Incidental Mutation 'R7718:Pkd1'
ID 595069
Institutional Source Beutler Lab
Gene Symbol Pkd1
Ensembl Gene ENSMUSG00000032855
Gene Name polycystin 1, transient receptor potential channel interacting
Synonyms polycystin-1, PC-1, PC1
MMRRC Submission 045775-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7718 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 24768808-24815482 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24805474 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 3313 (D3313G)
Ref Sequence ENSEMBL: ENSMUSP00000049296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035565] [ENSMUST00000227058] [ENSMUST00000228581]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000035565
AA Change: D3313G

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000049296
Gene: ENSMUSG00000032855
AA Change: D3313G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 32 71 1.61e-8 SMART
LRR_TYP 90 113 2.47e-5 SMART
LRRCT 125 177 3.84e-12 SMART
WSC 177 271 6.93e-34 SMART
PKD 272 355 2.72e-15 SMART
CLECT 406 530 5.72e-20 SMART
low complexity region 545 558 N/A INTRINSIC
low complexity region 763 788 N/A INTRINSIC
PKD 930 1008 1.06e-8 SMART
PKD 1015 1119 2.26e-12 SMART
PKD 1122 1205 2.03e-14 SMART
PKD 1208 1288 1.14e-17 SMART
PKD 1290 1373 2.35e-10 SMART
PKD 1374 1459 7.63e-10 SMART
PKD 1464 1541 1.95e-16 SMART
PKD 1544 1625 1.05e-16 SMART
PKD 1631 1714 1.93e-1 SMART
PKD 1716 1798 2.21e-15 SMART
PKD 1799 1882 5.7e-9 SMART
PKD 1884 1964 1.56e-6 SMART
PKD 1968 2056 3.1e-10 SMART
PKD 2057 2140 1.74e-13 SMART
Pfam:REJ 2167 2610 1e-108 PFAM
low complexity region 2697 2706 N/A INTRINSIC
GPS 3003 3052 1.33e-12 SMART
transmembrane domain 3065 3087 N/A INTRINSIC
LH2 3110 3224 3.5e-18 SMART
transmembrane domain 3275 3294 N/A INTRINSIC
transmembrane domain 3314 3336 N/A INTRINSIC
low complexity region 3357 3378 N/A INTRINSIC
low complexity region 3479 3492 N/A INTRINSIC
transmembrane domain 3547 3569 N/A INTRINSIC
low complexity region 3573 3591 N/A INTRINSIC
low complexity region 3626 3639 N/A INTRINSIC
low complexity region 3661 3676 N/A INTRINSIC
Pfam:PKD_channel 3701 4103 7.1e-125 PFAM
low complexity region 4153 4172 N/A INTRINSIC
low complexity region 4238 4256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227058
Predicted Effect
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000228581
Meta Mutation Damage Score 0.1265 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutant embryos begin to die after embryonic day (E) 14.5. They develop edema by E13.5, pancreatic cysts by E15.5 and kidney cysts by E16.5. Heterozygous adults develop cysts of the kidneys (~20-30%) and the liver (~10%) late in life. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted(28) Gene trapped(3) Chemically induced(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik A T 5: 138,646,122 (GRCm39) H669L possibly damaging Het
Abcb1a A T 5: 8,765,788 (GRCm39) N700I probably damaging Het
Abcc6 T C 7: 45,626,816 (GRCm39) K1414E possibly damaging Het
Adcy5 T C 16: 35,100,785 (GRCm39) V779A probably benign Het
Agap2 A G 10: 126,915,734 (GRCm39) S82G possibly damaging Het
Aldh1l1 A G 6: 90,575,305 (GRCm39) N864S probably damaging Het
Ang2 A T 14: 51,433,217 (GRCm39) V55E probably benign Het
Ank2 A G 3: 126,758,662 (GRCm39) M179T possibly damaging Het
Atrnl1 T A 19: 57,728,615 (GRCm39) C1090* probably null Het
Atxn1l A G 8: 110,459,866 (GRCm39) L132P probably damaging Het
Bptf A G 11: 106,972,282 (GRCm39) V862A possibly damaging Het
Capn11 C A 17: 45,954,707 (GRCm39) K143N probably damaging Het
Card6 A G 15: 5,129,269 (GRCm39) V709A possibly damaging Het
Cavin4 C T 4: 48,671,984 (GRCm39) A143V probably benign Het
Cntn5 A G 9: 9,984,133 (GRCm39) I160T probably benign Het
Cyp2c40 T A 19: 39,755,782 (GRCm39) N511Y probably benign Het
Dsc2 A T 18: 20,174,835 (GRCm39) I480N probably damaging Het
Elf2 G T 3: 51,173,385 (GRCm39) probably benign Het
Enoph1 T C 5: 100,210,019 (GRCm39) V133A possibly damaging Het
Ezh2 A T 6: 47,531,125 (GRCm39) D186E probably benign Het
Fcgbpl1 T C 7: 27,846,626 (GRCm39) F1106S probably damaging Het
Gfra1 T C 19: 58,441,889 (GRCm39) D14G possibly damaging Het
Gmip C T 8: 70,270,383 (GRCm39) R698W probably damaging Het
Grk4 A G 5: 34,852,160 (GRCm39) N135D probably benign Het
Hspb6 A G 7: 30,253,772 (GRCm39) D95G probably benign Het
Htatip2 T G 7: 49,420,632 (GRCm39) H159Q possibly damaging Het
Igfn1 T C 1: 135,896,774 (GRCm39) E1264G probably benign Het
Insyn2b T C 11: 34,352,539 (GRCm39) S194P probably benign Het
Katnb1 T A 8: 95,821,836 (GRCm39) V223E possibly damaging Het
Klra6 AGG AG 6: 129,990,315 (GRCm39) probably null Het
Masp2 C T 4: 148,687,204 (GRCm39) R29C probably damaging Het
Mcm3 A T 1: 20,887,498 (GRCm39) C123* probably null Het
Mdn1 T C 4: 32,718,420 (GRCm39) V2225A probably damaging Het
Me1 A G 9: 86,561,953 (GRCm39) L44S probably damaging Het
Mlxip A G 5: 123,583,577 (GRCm39) N380S probably benign Het
Muc21 T C 17: 35,933,728 (GRCm39) T153A unknown Het
Myh14 C T 7: 44,310,464 (GRCm39) V140I probably damaging Het
Myocd A T 11: 65,109,452 (GRCm39) D106E probably damaging Het
Oat T C 7: 132,159,988 (GRCm39) I411V probably benign Het
Or2d2 A T 7: 106,727,925 (GRCm39) V225D probably damaging Het
Or5p59 T C 7: 107,702,855 (GRCm39) V113A probably benign Het
Or8k38 A G 2: 86,488,373 (GRCm39) V143A probably benign Het
Orc2 A T 1: 58,519,476 (GRCm39) H246Q possibly damaging Het
Pank4 A G 4: 155,059,100 (GRCm39) E411G probably damaging Het
Patl2 A T 2: 121,957,255 (GRCm39) probably null Het
Pcdhb15 A G 18: 37,608,216 (GRCm39) N483D probably damaging Het
Pcdhb20 A G 18: 37,638,704 (GRCm39) D410G probably damaging Het
Pdcl2 A G 5: 76,465,846 (GRCm39) C125R probably damaging Het
Peli3 C G 19: 4,984,584 (GRCm39) probably null Het
Plec A C 15: 76,061,639 (GRCm39) M2766R probably damaging Het
Ppargc1a C T 5: 51,655,504 (GRCm39) V99M probably damaging Het
Prr35 T A 17: 26,165,998 (GRCm39) R430* probably null Het
Psg19 G A 7: 18,526,368 (GRCm39) A374V probably benign Het
Psmd7 A T 8: 108,313,261 (GRCm39) F54L possibly damaging Het
Ptbp2 C T 3: 119,514,637 (GRCm39) G397R probably null Het
Ranbp3 A G 17: 57,003,718 (GRCm39) D39G probably damaging Het
Rcor3 T C 1: 191,786,021 (GRCm39) T406A probably benign Het
Rhbdl2 T A 4: 123,718,712 (GRCm39) I222K probably damaging Het
Ripk2 T C 4: 16,151,968 (GRCm39) N197S possibly damaging Het
Rpia A T 6: 70,743,602 (GRCm39) M283K probably damaging Het
Rps6kc1 T C 1: 190,604,022 (GRCm39) D200G probably benign Het
Sipa1l1 A T 12: 82,389,271 (GRCm39) K499M probably damaging Het
Slc5a4b A G 10: 75,906,407 (GRCm39) L404P probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,222 (GRCm39) probably benign Het
Spmip4 G A 6: 50,566,078 (GRCm39) probably null Het
St7 A C 6: 17,854,998 (GRCm39) T312P probably damaging Het
Strbp T C 2: 37,515,294 (GRCm39) E244G probably damaging Het
Tbc1d8 T G 1: 39,416,061 (GRCm39) T871P probably benign Het
Tcp1 T A 17: 13,141,049 (GRCm39) I286N probably damaging Het
Tead3 C A 17: 28,552,491 (GRCm39) V327F probably damaging Het
Tmem132c A T 5: 127,640,504 (GRCm39) T892S probably benign Het
Trmt2a T C 16: 18,068,487 (GRCm39) S65P probably benign Het
Ubp1 A G 9: 113,802,597 (GRCm39) N479S possibly damaging Het
Ubtfl1 A T 9: 18,320,527 (GRCm39) L18F possibly damaging Het
Uevld T G 7: 46,587,804 (GRCm39) M299L probably benign Het
Unc13b T A 4: 43,173,854 (GRCm39) Y1561N unknown Het
Ylpm1 A G 12: 85,075,896 (GRCm39) K874E probably damaging Het
Zbtb37 G A 1: 160,859,802 (GRCm39) R168W possibly damaging Het
Other mutations in Pkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pkd1 APN 17 24,799,069 (GRCm39) missense probably damaging 1.00
IGL00503:Pkd1 APN 17 24,784,401 (GRCm39) missense probably benign
IGL00549:Pkd1 APN 17 24,791,735 (GRCm39) missense probably benign
IGL00573:Pkd1 APN 17 24,813,504 (GRCm39) nonsense probably null
IGL00924:Pkd1 APN 17 24,790,601 (GRCm39) nonsense probably null
IGL01319:Pkd1 APN 17 24,806,893 (GRCm39) unclassified probably benign
IGL01326:Pkd1 APN 17 24,795,148 (GRCm39) nonsense probably null
IGL01457:Pkd1 APN 17 24,813,795 (GRCm39) splice site probably null
IGL01541:Pkd1 APN 17 24,805,272 (GRCm39) missense probably damaging 1.00
IGL01575:Pkd1 APN 17 24,792,102 (GRCm39) missense probably damaging 1.00
IGL01606:Pkd1 APN 17 24,795,497 (GRCm39) missense probably damaging 0.97
IGL01642:Pkd1 APN 17 24,800,266 (GRCm39) missense probably damaging 1.00
IGL01888:Pkd1 APN 17 24,804,789 (GRCm39) missense possibly damaging 0.91
IGL01940:Pkd1 APN 17 24,798,720 (GRCm39) missense possibly damaging 0.63
IGL01958:Pkd1 APN 17 24,799,298 (GRCm39) missense probably damaging 1.00
IGL02005:Pkd1 APN 17 24,804,978 (GRCm39) missense possibly damaging 0.67
IGL02121:Pkd1 APN 17 24,794,901 (GRCm39) missense probably benign 0.03
IGL02148:Pkd1 APN 17 24,798,810 (GRCm39) missense probably damaging 1.00
IGL02409:Pkd1 APN 17 24,792,597 (GRCm39) missense probably benign 0.01
IGL02442:Pkd1 APN 17 24,784,200 (GRCm39) missense probably benign 0.41
IGL02498:Pkd1 APN 17 24,804,753 (GRCm39) missense possibly damaging 0.91
IGL02501:Pkd1 APN 17 24,788,673 (GRCm39) missense probably benign 0.01
IGL02551:Pkd1 APN 17 24,792,789 (GRCm39) missense probably damaging 1.00
IGL02635:Pkd1 APN 17 24,791,785 (GRCm39) missense probably damaging 1.00
IGL02673:Pkd1 APN 17 24,790,257 (GRCm39) missense probably benign 0.40
IGL02808:Pkd1 APN 17 24,812,478 (GRCm39) missense probably damaging 1.00
IGL02816:Pkd1 APN 17 24,813,489 (GRCm39) missense probably benign 0.00
IGL02863:Pkd1 APN 17 24,788,726 (GRCm39) missense possibly damaging 0.56
IGL02927:Pkd1 APN 17 24,794,163 (GRCm39) missense probably damaging 1.00
IGL02961:Pkd1 APN 17 24,797,089 (GRCm39) missense possibly damaging 0.81
IGL03003:Pkd1 APN 17 24,812,577 (GRCm39) critical splice donor site probably null
IGL03066:Pkd1 APN 17 24,805,208 (GRCm39) missense probably damaging 1.00
IGL03182:Pkd1 APN 17 24,792,792 (GRCm39) missense probably damaging 0.98
IGL03384:Pkd1 APN 17 24,784,871 (GRCm39) missense probably benign 0.00
IGL03404:Pkd1 APN 17 24,783,380 (GRCm39) missense probably damaging 0.97
PIT1430001:Pkd1 UTSW 17 24,788,485 (GRCm39) missense probably damaging 0.99
PIT4494001:Pkd1 UTSW 17 24,796,775 (GRCm39) missense probably damaging 1.00
PIT4677001:Pkd1 UTSW 17 24,793,003 (GRCm39) missense possibly damaging 0.94
R0017:Pkd1 UTSW 17 24,797,513 (GRCm39) critical splice donor site probably null
R0017:Pkd1 UTSW 17 24,797,513 (GRCm39) critical splice donor site probably null
R0022:Pkd1 UTSW 17 24,813,793 (GRCm39) missense probably damaging 0.98
R0022:Pkd1 UTSW 17 24,813,793 (GRCm39) missense probably damaging 0.98
R0058:Pkd1 UTSW 17 24,783,677 (GRCm39) missense probably benign 0.06
R0058:Pkd1 UTSW 17 24,783,677 (GRCm39) missense probably benign 0.06
R0085:Pkd1 UTSW 17 24,805,197 (GRCm39) missense probably damaging 0.98
R0094:Pkd1 UTSW 17 24,800,250 (GRCm39) missense possibly damaging 0.80
R0094:Pkd1 UTSW 17 24,800,250 (GRCm39) missense possibly damaging 0.80
R0135:Pkd1 UTSW 17 24,784,045 (GRCm39) missense possibly damaging 0.85
R0304:Pkd1 UTSW 17 24,804,920 (GRCm39) missense probably damaging 1.00
R0427:Pkd1 UTSW 17 24,812,476 (GRCm39) missense probably damaging 0.98
R0502:Pkd1 UTSW 17 24,793,766 (GRCm39) missense probably damaging 0.99
R0518:Pkd1 UTSW 17 24,814,193 (GRCm39) missense probably benign 0.01
R0521:Pkd1 UTSW 17 24,814,193 (GRCm39) missense probably benign 0.01
R0544:Pkd1 UTSW 17 24,804,657 (GRCm39) missense probably damaging 1.00
R0546:Pkd1 UTSW 17 24,799,112 (GRCm39) missense probably benign 0.44
R0626:Pkd1 UTSW 17 24,794,549 (GRCm39) missense probably damaging 0.96
R0648:Pkd1 UTSW 17 24,813,911 (GRCm39) missense probably damaging 1.00
R1138:Pkd1 UTSW 17 24,805,006 (GRCm39) missense probably damaging 1.00
R1302:Pkd1 UTSW 17 24,787,210 (GRCm39) missense probably benign 0.00
R1306:Pkd1 UTSW 17 24,792,146 (GRCm39) missense probably damaging 0.97
R1349:Pkd1 UTSW 17 24,794,240 (GRCm39) missense probably damaging 1.00
R1372:Pkd1 UTSW 17 24,794,240 (GRCm39) missense probably damaging 1.00
R1437:Pkd1 UTSW 17 24,814,106 (GRCm39) missense probably damaging 1.00
R1515:Pkd1 UTSW 17 24,813,827 (GRCm39) missense probably benign 0.01
R1605:Pkd1 UTSW 17 24,796,500 (GRCm39) missense possibly damaging 0.95
R1622:Pkd1 UTSW 17 24,800,614 (GRCm39) missense probably benign
R1623:Pkd1 UTSW 17 24,797,243 (GRCm39) missense probably damaging 0.99
R1726:Pkd1 UTSW 17 24,783,150 (GRCm39) missense probably damaging 0.96
R1756:Pkd1 UTSW 17 24,813,459 (GRCm39) missense probably damaging 1.00
R1780:Pkd1 UTSW 17 24,800,543 (GRCm39) missense probably benign
R1785:Pkd1 UTSW 17 24,810,073 (GRCm39) missense probably benign 0.00
R1829:Pkd1 UTSW 17 24,784,558 (GRCm39) missense probably benign
R1869:Pkd1 UTSW 17 24,813,905 (GRCm39) missense probably damaging 1.00
R1920:Pkd1 UTSW 17 24,814,131 (GRCm39) missense probably damaging 0.99
R1922:Pkd1 UTSW 17 24,814,131 (GRCm39) missense probably damaging 0.99
R1987:Pkd1 UTSW 17 24,795,566 (GRCm39) splice site probably null
R1988:Pkd1 UTSW 17 24,795,566 (GRCm39) splice site probably null
R1998:Pkd1 UTSW 17 24,791,988 (GRCm39) missense probably damaging 1.00
R2007:Pkd1 UTSW 17 24,798,759 (GRCm39) missense probably damaging 1.00
R2019:Pkd1 UTSW 17 24,787,658 (GRCm39) nonsense probably null
R2054:Pkd1 UTSW 17 24,793,770 (GRCm39) missense probably benign 0.00
R2061:Pkd1 UTSW 17 24,788,888 (GRCm39) missense possibly damaging 0.89
R2196:Pkd1 UTSW 17 24,799,046 (GRCm39) missense possibly damaging 0.60
R2203:Pkd1 UTSW 17 24,799,863 (GRCm39) missense probably benign 0.01
R2301:Pkd1 UTSW 17 24,793,586 (GRCm39) missense probably benign
R2655:Pkd1 UTSW 17 24,795,464 (GRCm39) missense probably damaging 0.99
R2860:Pkd1 UTSW 17 24,784,420 (GRCm39) missense probably benign 0.43
R2861:Pkd1 UTSW 17 24,784,420 (GRCm39) missense probably benign 0.43
R3000:Pkd1 UTSW 17 24,813,460 (GRCm39) missense probably damaging 1.00
R3150:Pkd1 UTSW 17 24,798,765 (GRCm39) missense probably benign 0.00
R3747:Pkd1 UTSW 17 24,810,435 (GRCm39) missense possibly damaging 0.67
R3812:Pkd1 UTSW 17 24,784,615 (GRCm39) missense probably benign 0.00
R3859:Pkd1 UTSW 17 24,797,066 (GRCm39) splice site probably benign
R3893:Pkd1 UTSW 17 24,791,084 (GRCm39) critical splice donor site probably null
R3947:Pkd1 UTSW 17 24,797,011 (GRCm39) splice site probably benign
R3949:Pkd1 UTSW 17 24,797,011 (GRCm39) splice site probably benign
R4176:Pkd1 UTSW 17 24,806,971 (GRCm39) missense probably benign 0.17
R4199:Pkd1 UTSW 17 24,789,004 (GRCm39) missense probably benign 0.41
R4225:Pkd1 UTSW 17 24,812,497 (GRCm39) missense possibly damaging 0.50
R4439:Pkd1 UTSW 17 24,804,666 (GRCm39) missense probably damaging 1.00
R4476:Pkd1 UTSW 17 24,795,500 (GRCm39) missense probably damaging 1.00
R4716:Pkd1 UTSW 17 24,795,107 (GRCm39) missense probably damaging 1.00
R4801:Pkd1 UTSW 17 24,797,070 (GRCm39) missense probably damaging 1.00
R4802:Pkd1 UTSW 17 24,797,070 (GRCm39) missense probably damaging 1.00
R4817:Pkd1 UTSW 17 24,784,348 (GRCm39) splice site probably null
R4903:Pkd1 UTSW 17 24,790,976 (GRCm39) missense probably benign 0.30
R4910:Pkd1 UTSW 17 24,791,661 (GRCm39) missense probably damaging 1.00
R4964:Pkd1 UTSW 17 24,805,042 (GRCm39) critical splice donor site probably null
R4966:Pkd1 UTSW 17 24,805,042 (GRCm39) critical splice donor site probably null
R5040:Pkd1 UTSW 17 24,790,234 (GRCm39) missense probably benign 0.02
R5042:Pkd1 UTSW 17 24,788,861 (GRCm39) missense probably benign 0.00
R5088:Pkd1 UTSW 17 24,809,812 (GRCm39) missense possibly damaging 0.94
R5121:Pkd1 UTSW 17 24,792,437 (GRCm39) missense probably benign
R5296:Pkd1 UTSW 17 24,795,048 (GRCm39) missense probably damaging 1.00
R5338:Pkd1 UTSW 17 24,813,510 (GRCm39) missense probably benign
R5356:Pkd1 UTSW 17 24,812,551 (GRCm39) missense probably damaging 0.97
R5357:Pkd1 UTSW 17 24,784,764 (GRCm39) missense probably damaging 1.00
R5363:Pkd1 UTSW 17 24,784,047 (GRCm39) missense probably benign
R5383:Pkd1 UTSW 17 24,793,349 (GRCm39) missense probably benign
R5622:Pkd1 UTSW 17 24,793,014 (GRCm39) missense possibly damaging 0.67
R5651:Pkd1 UTSW 17 24,810,361 (GRCm39) missense possibly damaging 0.88
R5664:Pkd1 UTSW 17 24,788,345 (GRCm39) missense probably damaging 0.99
R5723:Pkd1 UTSW 17 24,784,497 (GRCm39) missense probably benign 0.01
R5797:Pkd1 UTSW 17 24,811,615 (GRCm39) missense possibly damaging 0.55
R5838:Pkd1 UTSW 17 24,799,186 (GRCm39) missense possibly damaging 0.75
R5866:Pkd1 UTSW 17 24,799,935 (GRCm39) missense probably damaging 0.99
R5873:Pkd1 UTSW 17 24,788,804 (GRCm39) missense probably benign
R5906:Pkd1 UTSW 17 24,791,894 (GRCm39) missense probably benign 0.16
R6047:Pkd1 UTSW 17 24,814,059 (GRCm39) missense probably damaging 1.00
R6076:Pkd1 UTSW 17 24,800,004 (GRCm39) missense probably benign 0.14
R6151:Pkd1 UTSW 17 24,794,580 (GRCm39) missense probably benign 0.00
R6252:Pkd1 UTSW 17 24,800,200 (GRCm39) missense probably damaging 0.98
R6341:Pkd1 UTSW 17 24,799,201 (GRCm39) missense probably damaging 1.00
R6540:Pkd1 UTSW 17 24,794,951 (GRCm39) missense probably damaging 1.00
R6732:Pkd1 UTSW 17 24,788,387 (GRCm39) missense probably damaging 1.00
R6836:Pkd1 UTSW 17 24,800,233 (GRCm39) missense probably damaging 1.00
R6856:Pkd1 UTSW 17 24,792,467 (GRCm39) missense probably benign 0.05
R6865:Pkd1 UTSW 17 24,795,461 (GRCm39) missense probably benign 0.43
R6999:Pkd1 UTSW 17 24,797,475 (GRCm39) missense possibly damaging 0.62
R7077:Pkd1 UTSW 17 24,810,093 (GRCm39) missense probably damaging 1.00
R7123:Pkd1 UTSW 17 24,813,742 (GRCm39) missense possibly damaging 0.89
R7134:Pkd1 UTSW 17 24,813,086 (GRCm39) missense probably damaging 0.99
R7210:Pkd1 UTSW 17 24,794,840 (GRCm39) missense probably damaging 0.98
R7323:Pkd1 UTSW 17 24,794,025 (GRCm39) missense probably benign 0.01
R7380:Pkd1 UTSW 17 24,800,616 (GRCm39) missense probably damaging 1.00
R7407:Pkd1 UTSW 17 24,813,568 (GRCm39) missense probably damaging 1.00
R7410:Pkd1 UTSW 17 24,794,855 (GRCm39) missense probably damaging 1.00
R7492:Pkd1 UTSW 17 24,788,715 (GRCm39) missense probably benign 0.04
R7517:Pkd1 UTSW 17 24,799,393 (GRCm39) missense probably damaging 1.00
R7543:Pkd1 UTSW 17 24,814,227 (GRCm39) missense probably damaging 0.99
R7560:Pkd1 UTSW 17 24,792,605 (GRCm39) missense probably benign 0.33
R7615:Pkd1 UTSW 17 24,812,476 (GRCm39) missense probably damaging 0.98
R7714:Pkd1 UTSW 17 24,769,250 (GRCm39) missense unknown
R7731:Pkd1 UTSW 17 24,792,872 (GRCm39) missense probably damaging 1.00
R7849:Pkd1 UTSW 17 24,805,174 (GRCm39) missense probably damaging 0.98
R7859:Pkd1 UTSW 17 24,790,254 (GRCm39) missense probably damaging 1.00
R7866:Pkd1 UTSW 17 24,809,881 (GRCm39) missense probably benign 0.26
R7915:Pkd1 UTSW 17 24,811,630 (GRCm39) nonsense probably null
R7991:Pkd1 UTSW 17 24,791,595 (GRCm39) missense possibly damaging 0.95
R8050:Pkd1 UTSW 17 24,784,617 (GRCm39) missense probably benign 0.26
R8086:Pkd1 UTSW 17 24,800,188 (GRCm39) missense probably damaging 1.00
R8312:Pkd1 UTSW 17 24,786,102 (GRCm39) missense probably benign 0.02
R8385:Pkd1 UTSW 17 24,794,702 (GRCm39) missense possibly damaging 0.67
R8393:Pkd1 UTSW 17 24,791,621 (GRCm39) missense probably damaging 0.99
R8552:Pkd1 UTSW 17 24,810,443 (GRCm39) missense probably damaging 1.00
R8753:Pkd1 UTSW 17 24,793,176 (GRCm39) missense probably damaging 1.00
R8822:Pkd1 UTSW 17 24,784,615 (GRCm39) missense probably benign 0.00
R8855:Pkd1 UTSW 17 24,792,051 (GRCm39) missense probably damaging 1.00
R8866:Pkd1 UTSW 17 24,792,051 (GRCm39) missense probably damaging 1.00
R8867:Pkd1 UTSW 17 24,792,807 (GRCm39) missense probably damaging 1.00
R8960:Pkd1 UTSW 17 24,795,176 (GRCm39) missense probably damaging 1.00
R8966:Pkd1 UTSW 17 24,794,751 (GRCm39) missense possibly damaging 0.69
R9004:Pkd1 UTSW 17 24,799,421 (GRCm39) missense probably benign
R9015:Pkd1 UTSW 17 24,784,636 (GRCm39) nonsense probably null
R9069:Pkd1 UTSW 17 24,791,988 (GRCm39) missense probably damaging 1.00
R9092:Pkd1 UTSW 17 24,788,347 (GRCm39) missense possibly damaging 0.93
R9135:Pkd1 UTSW 17 24,790,976 (GRCm39) missense
R9307:Pkd1 UTSW 17 24,769,451 (GRCm39) missense possibly damaging 0.90
R9312:Pkd1 UTSW 17 24,797,364 (GRCm39) missense probably damaging 1.00
R9313:Pkd1 UTSW 17 24,813,932 (GRCm39) missense probably damaging 1.00
R9380:Pkd1 UTSW 17 24,769,262 (GRCm39) missense unknown
R9383:Pkd1 UTSW 17 24,794,900 (GRCm39) missense probably damaging 1.00
R9531:Pkd1 UTSW 17 24,792,114 (GRCm39) missense probably damaging 0.99
R9617:Pkd1 UTSW 17 24,800,341 (GRCm39) missense probably damaging 1.00
R9691:Pkd1 UTSW 17 24,796,812 (GRCm39) missense possibly damaging 0.77
R9792:Pkd1 UTSW 17 24,800,172 (GRCm39) missense probably benign
R9793:Pkd1 UTSW 17 24,800,172 (GRCm39) missense probably benign
X0024:Pkd1 UTSW 17 24,810,366 (GRCm39) missense possibly damaging 0.68
X0061:Pkd1 UTSW 17 24,813,905 (GRCm39) missense probably damaging 1.00
X0065:Pkd1 UTSW 17 24,805,138 (GRCm39) missense probably benign 0.19
Z1088:Pkd1 UTSW 17 24,784,579 (GRCm39) missense probably benign 0.44
Z1177:Pkd1 UTSW 17 24,794,465 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAATGCTGTGTGGTACGG -3'
(R):5'- TGTGAGTCTTCAATGGCTGC -3'

Sequencing Primer
(F):5'- TACGGAGTTGTGAGAGACACCAC -3'
(R):5'- GATCCACCTGCCTCTGGGATTAAAG -3'
Posted On 2019-11-12