Mutagenetix > Incidental Mutations

Incidental Mutation 'R7718:Dsc2'

595075

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7718 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20041778 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 480 (I480N)

Ref Sequence

ENSEMBL: ENSMUSP00000042905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039247
AA Change: I480N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: I480N

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000075214
AA Change: I480N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: I480N

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155407

SMART Domains

Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
SCOP:d1l3wa5	2	71	2e-3	SMART
Blast:CA	2	76	2e-47	BLAST
transmembrane domain	96	118	N/A	INTRINSIC

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	G	A	6: 50,589,098		probably null	Het
9530053A07Rik	T	C	7: 28,147,201	F1106S	probably damaging	Het
A430033K04Rik	A	T	5: 138,647,860	H669L	possibly damaging	Het
A930017K11Rik	T	A	17: 25,947,024	R430*	probably null	Het
Abcb1a	A	T	5: 8,715,788	N700I	probably damaging	Het
Abcc6	T	C	7: 45,977,392	K1414E	possibly damaging	Het
Adcy5	T	C	16: 35,280,415	V779A	probably benign	Het
Agap2	A	G	10: 127,079,865	S82G	possibly damaging	Het
Aldh1l1	A	G	6: 90,598,323	N864S	probably damaging	Het
Ang2	A	T	14: 51,195,760	V55E	probably benign	Het
Ank2	A	G	3: 126,965,013	M179T	possibly damaging	Het
Atrnl1	T	A	19: 57,740,183	C1090*	probably null	Het
Atxn1l	A	G	8: 109,733,234	L132P	probably damaging	Het
Bptf	A	G	11: 107,081,456	V862A	possibly damaging	Het
Capn11	C	A	17: 45,643,781	K143N	probably damaging	Het
Card6	A	G	15: 5,099,787	V709A	possibly damaging	Het
Cavin4	C	T	4: 48,671,984	A143V	probably benign	Het
Cntn5	A	G	9: 9,984,128	I160T	probably benign	Het
Cyp2c40	T	A	19: 39,767,338	N511Y	probably benign	Het
Elf2	G	T	3: 51,265,964		probably benign	Het
Enoph1	T	C	5: 100,062,160	V133A	possibly damaging	Het
Ezh2	A	T	6: 47,554,191	D186E	probably benign	Het
Fam196b	T	C	11: 34,402,539	S194P	probably benign	Het
Gfra1	T	C	19: 58,453,457	D14G	possibly damaging	Het
Gm9573	T	C	17: 35,622,836	T153A	unknown	Het
Gmip	C	T	8: 69,817,733	R698W	probably damaging	Het
Grk4	A	G	5: 34,694,816	N135D	probably benign	Het
Hspb6	A	G	7: 30,554,347	D95G	probably benign	Het
Htatip2	T	G	7: 49,770,884	H159Q	possibly damaging	Het
Igfn1	T	C	1: 135,969,036	E1264G	probably benign	Het
Katnb1	T	A	8: 95,095,208	V223E	possibly damaging	Het
Klra6	AGG	AG	6: 130,013,352		probably null	Het
Masp2	C	T	4: 148,602,747	R29C	probably damaging	Het
Mcm3	A	T	1: 20,817,274	C123*	probably null	Het
Mdn1	T	C	4: 32,718,420	V2225A	probably damaging	Het
Me1	A	G	9: 86,679,900	L44S	probably damaging	Het
Mlxip	A	G	5: 123,445,514	N380S	probably benign	Het
Myh14	C	T	7: 44,661,040	V140I	probably damaging	Het
Myocd	A	T	11: 65,218,626	D106E	probably damaging	Het
Oat	T	C	7: 132,558,259	I411V	probably benign	Het
Olfr1085	A	G	2: 86,658,029	V143A	probably benign	Het
Olfr483	T	C	7: 108,103,648	V113A	probably benign	Het
Olfr715	A	T	7: 107,128,718	V225D	probably damaging	Het
Orc2	A	T	1: 58,480,317	H246Q	possibly damaging	Het
Pank4	A	G	4: 154,974,643	E411G	probably damaging	Het
Patl2	A	T	2: 122,126,774		probably null	Het
Pcdhb15	A	G	18: 37,475,163	N483D	probably damaging	Het
Pcdhb20	A	G	18: 37,505,651	D410G	probably damaging	Het
Pdcl2	A	G	5: 76,317,999	C125R	probably damaging	Het
Peli3	C	G	19: 4,934,556		probably null	Het
Pkd1	A	G	17: 24,586,500	D3313G	probably benign	Het
Plec	A	C	15: 76,177,439	M2766R	probably damaging	Het
Ppargc1a	C	T	5: 51,498,162	V99M	probably damaging	Het
Psg19	G	A	7: 18,792,443	A374V	probably benign	Het
Psmd7	A	T	8: 107,586,629	F54L	possibly damaging	Het
Ptbp2	C	T	3: 119,720,988	G397R	probably null	Het
Ranbp3	A	G	17: 56,696,718	D39G	probably damaging	Het
Rcor3	T	C	1: 192,101,721	T406A	probably benign	Het
Rhbdl2	T	A	4: 123,824,919	I222K	probably damaging	Het
Ripk2	T	C	4: 16,151,968	N197S	possibly damaging	Het
Rpia	A	T	6: 70,766,618	M283K	probably damaging	Het
Rps6kc1	T	C	1: 190,871,825	D200G	probably benign	Het
Sipa1l1	A	T	12: 82,342,497	K499M	probably damaging	Het
Slc5a4b	A	G	10: 76,070,573	L404P	probably damaging	Het
Son	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	16: 91,660,334		probably benign	Het
St7	A	C	6: 17,854,999	T312P	probably damaging	Het
Strbp	T	C	2: 37,625,282	E244G	probably damaging	Het
Tbc1d8	T	G	1: 39,376,980	T871P	probably benign	Het
Tcp1	T	A	17: 12,922,162	I286N	probably damaging	Het
Tead3	C	A	17: 28,333,517	V327F	probably damaging	Het
Tmem132c	A	T	5: 127,563,440	T892S	probably benign	Het
Trmt2a	T	C	16: 18,250,623	S65P	probably benign	Het
Ubp1	A	G	9: 113,973,529	N479S	possibly damaging	Het
Ubtfl1	A	T	9: 18,409,231	L18F	possibly damaging	Het
Uevld	T	G	7: 46,938,056	M299L	probably benign	Het
Unc13b	T	A	4: 43,173,854	Y1561N	unknown	Het
Ylpm1	A	G	12: 85,029,122	K874E	probably damaging	Het
Zbtb37	G	A	1: 161,032,232	R168W	possibly damaging	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACAGTGACCCACCCTCTTG -3'
(R):5'- TCTGGACTATGAAGAACGGC -3'

Sequencing Primer
(F):5'- TGTTAACCACAGTGAAGGAACAC -3'
(R):5'- GAACGGCAACAGGTGACCC -3'

Posted On

2019-11-12