Incidental Mutation 'R7718:Pcdhb20'
ID595077
Institutional Source Beutler Lab
Gene Symbol Pcdhb20
Ensembl Gene ENSMUSG00000046191
Gene Nameprotocadherin beta 20
SynonymsPcdhbT, Pcdhb14
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7718 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37504264-37507822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37505651 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 410 (D410G)
Ref Sequence ENSEMBL: ENSMUSP00000137038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052179] [ENSMUST00000059571] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000052179
AA Change: D410G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137038
Gene: ENSMUSG00000046191
AA Change: D410G

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 8.3e-36 PFAM
low complexity region 136 148 N/A INTRINSIC
CA 155 240 1.41e-19 SMART
CA 264 345 2.91e-21 SMART
CA 368 449 1.12e-22 SMART
CA 473 559 3.41e-27 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 769 7.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059571
SMART Domains Protein: ENSMUSP00000053326
Gene: ENSMUSG00000043313

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 45 131 4.8e-1 SMART
CA 155 240 6.58e-20 SMART
CA 264 345 1.03e-21 SMART
CA 368 449 4.21e-18 SMART
CA 473 559 3.36e-26 SMART
CA 589 670 6.69e-12 SMART
Pfam:Cadherin_C_2 686 769 1.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.8559 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik G A 6: 50,589,098 probably null Het
9530053A07Rik T C 7: 28,147,201 F1106S probably damaging Het
A430033K04Rik A T 5: 138,647,860 H669L possibly damaging Het
A930017K11Rik T A 17: 25,947,024 R430* probably null Het
Abcb1a A T 5: 8,715,788 N700I probably damaging Het
Abcc6 T C 7: 45,977,392 K1414E possibly damaging Het
Adcy5 T C 16: 35,280,415 V779A probably benign Het
Agap2 A G 10: 127,079,865 S82G possibly damaging Het
Aldh1l1 A G 6: 90,598,323 N864S probably damaging Het
Ang2 A T 14: 51,195,760 V55E probably benign Het
Ank2 A G 3: 126,965,013 M179T possibly damaging Het
Atrnl1 T A 19: 57,740,183 C1090* probably null Het
Atxn1l A G 8: 109,733,234 L132P probably damaging Het
Bptf A G 11: 107,081,456 V862A possibly damaging Het
Capn11 C A 17: 45,643,781 K143N probably damaging Het
Card6 A G 15: 5,099,787 V709A possibly damaging Het
Cavin4 C T 4: 48,671,984 A143V probably benign Het
Cntn5 A G 9: 9,984,128 I160T probably benign Het
Cyp2c40 T A 19: 39,767,338 N511Y probably benign Het
Dsc2 A T 18: 20,041,778 I480N probably damaging Het
Elf2 G T 3: 51,265,964 probably benign Het
Enoph1 T C 5: 100,062,160 V133A possibly damaging Het
Ezh2 A T 6: 47,554,191 D186E probably benign Het
Fam196b T C 11: 34,402,539 S194P probably benign Het
Gfra1 T C 19: 58,453,457 D14G possibly damaging Het
Gm9573 T C 17: 35,622,836 T153A unknown Het
Gmip C T 8: 69,817,733 R698W probably damaging Het
Grk4 A G 5: 34,694,816 N135D probably benign Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Htatip2 T G 7: 49,770,884 H159Q possibly damaging Het
Igfn1 T C 1: 135,969,036 E1264G probably benign Het
Katnb1 T A 8: 95,095,208 V223E possibly damaging Het
Klra6 AGG AG 6: 130,013,352 probably null Het
Masp2 C T 4: 148,602,747 R29C probably damaging Het
Mcm3 A T 1: 20,817,274 C123* probably null Het
Mdn1 T C 4: 32,718,420 V2225A probably damaging Het
Me1 A G 9: 86,679,900 L44S probably damaging Het
Mlxip A G 5: 123,445,514 N380S probably benign Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Myocd A T 11: 65,218,626 D106E probably damaging Het
Oat T C 7: 132,558,259 I411V probably benign Het
Olfr1085 A G 2: 86,658,029 V143A probably benign Het
Olfr483 T C 7: 108,103,648 V113A probably benign Het
Olfr715 A T 7: 107,128,718 V225D probably damaging Het
Orc2 A T 1: 58,480,317 H246Q possibly damaging Het
Pank4 A G 4: 154,974,643 E411G probably damaging Het
Patl2 A T 2: 122,126,774 probably null Het
Pcdhb15 A G 18: 37,475,163 N483D probably damaging Het
Pdcl2 A G 5: 76,317,999 C125R probably damaging Het
Peli3 C G 19: 4,934,556 probably null Het
Pkd1 A G 17: 24,586,500 D3313G probably benign Het
Plec A C 15: 76,177,439 M2766R probably damaging Het
Ppargc1a C T 5: 51,498,162 V99M probably damaging Het
Psg19 G A 7: 18,792,443 A374V probably benign Het
Psmd7 A T 8: 107,586,629 F54L possibly damaging Het
Ptbp2 C T 3: 119,720,988 G397R probably null Het
Ranbp3 A G 17: 56,696,718 D39G probably damaging Het
Rcor3 T C 1: 192,101,721 T406A probably benign Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Rpia A T 6: 70,766,618 M283K probably damaging Het
Rps6kc1 T C 1: 190,871,825 D200G probably benign Het
Sipa1l1 A T 12: 82,342,497 K499M probably damaging Het
Slc5a4b A G 10: 76,070,573 L404P probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St7 A C 6: 17,854,999 T312P probably damaging Het
Strbp T C 2: 37,625,282 E244G probably damaging Het
Tbc1d8 T G 1: 39,376,980 T871P probably benign Het
Tcp1 T A 17: 12,922,162 I286N probably damaging Het
Tead3 C A 17: 28,333,517 V327F probably damaging Het
Tmem132c A T 5: 127,563,440 T892S probably benign Het
Trmt2a T C 16: 18,250,623 S65P probably benign Het
Ubp1 A G 9: 113,973,529 N479S possibly damaging Het
Ubtfl1 A T 9: 18,409,231 L18F possibly damaging Het
Uevld T G 7: 46,938,056 M299L probably benign Het
Unc13b T A 4: 43,173,854 Y1561N unknown Het
Ylpm1 A G 12: 85,029,122 K874E probably damaging Het
Zbtb37 G A 1: 161,032,232 R168W possibly damaging Het
Other mutations in Pcdhb20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Pcdhb20 APN 18 37504685 missense possibly damaging 0.87
IGL01373:Pcdhb20 APN 18 37506568 missense probably benign 0.10
IGL01556:Pcdhb20 APN 18 37504799 missense possibly damaging 0.88
IGL01621:Pcdhb20 APN 18 37504807 missense possibly damaging 0.49
IGL01768:Pcdhb20 APN 18 37506715 missense possibly damaging 0.80
IGL01859:Pcdhb20 APN 18 37504563 missense probably damaging 0.98
IGL02492:Pcdhb20 APN 18 37506400 missense probably benign 0.43
IGL03057:Pcdhb20 APN 18 37504798 missense possibly damaging 0.74
IGL02991:Pcdhb20 UTSW 18 37506211 missense probably damaging 1.00
R0799:Pcdhb20 UTSW 18 37505885 missense probably damaging 1.00
R1465:Pcdhb20 UTSW 18 37504697 missense probably damaging 0.99
R1465:Pcdhb20 UTSW 18 37504697 missense probably damaging 0.99
R2012:Pcdhb20 UTSW 18 37505074 missense probably damaging 0.99
R2079:Pcdhb20 UTSW 18 37505171 missense probably benign 0.07
R2350:Pcdhb20 UTSW 18 37504510 missense probably benign 0.01
R2363:Pcdhb20 UTSW 18 37505672 missense probably damaging 1.00
R2364:Pcdhb20 UTSW 18 37505938 missense probably damaging 1.00
R2870:Pcdhb20 UTSW 18 37505780 missense possibly damaging 0.82
R2870:Pcdhb20 UTSW 18 37505780 missense possibly damaging 0.82
R4060:Pcdhb20 UTSW 18 37506164 missense probably damaging 1.00
R4609:Pcdhb20 UTSW 18 37505796 missense probably benign 0.02
R4750:Pcdhb20 UTSW 18 37506131 missense possibly damaging 0.48
R4897:Pcdhb20 UTSW 18 37506245 missense possibly damaging 0.70
R4970:Pcdhb20 UTSW 18 37506771 missense probably benign 0.00
R5098:Pcdhb20 UTSW 18 37504805 missense probably damaging 1.00
R5616:Pcdhb20 UTSW 18 37504532 missense probably damaging 0.97
R5890:Pcdhb20 UTSW 18 37505233 missense probably benign 0.00
R6225:Pcdhb20 UTSW 18 37504994 missense probably damaging 1.00
R6248:Pcdhb20 UTSW 18 37506232 missense probably damaging 0.99
R6419:Pcdhb20 UTSW 18 37505555 missense probably damaging 1.00
R6814:Pcdhb20 UTSW 18 37506165 missense probably benign 0.22
R6821:Pcdhb20 UTSW 18 37506122 missense probably damaging 1.00
R6824:Pcdhb20 UTSW 18 37505699 missense probably benign 0.06
R6872:Pcdhb20 UTSW 18 37506165 missense probably benign 0.22
R7040:Pcdhb20 UTSW 18 37504717 missense probably benign 0.00
R7145:Pcdhb20 UTSW 18 37505089 missense probably damaging 1.00
R7165:Pcdhb20 UTSW 18 37505070 missense probably damaging 1.00
R7215:Pcdhb20 UTSW 18 37505386 missense probably benign 0.24
R7265:Pcdhb20 UTSW 18 37505563 missense possibly damaging 0.95
R7372:Pcdhb20 UTSW 18 37506787 missense probably benign 0.00
R7402:Pcdhb20 UTSW 18 37504952 missense probably benign 0.05
R7794:Pcdhb20 UTSW 18 37504432 missense probably benign 0.00
R7842:Pcdhb20 UTSW 18 37505059 missense possibly damaging 0.94
R7925:Pcdhb20 UTSW 18 37505059 missense possibly damaging 0.94
R8084:Pcdhb20 UTSW 18 37506173 missense possibly damaging 0.95
R8133:Pcdhb20 UTSW 18 37506610 nonsense probably null
Z1177:Pcdhb20 UTSW 18 37504588 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCATGTCGTCGGTTACAAAGG -3'
(R):5'- CCTGAGTCTTTGTCTGTGGCAC -3'

Sequencing Primer
(F):5'- GTCGTCGGTTACAAAGGCAATTCC -3'
(R):5'- CACTGATGGTGCCTATGTGCAG -3'
Posted On2019-11-12