Mutagenetix > Incidental Mutation

Incidental Mutation 'R7718:Atrnl1'

595080

Institutional Source

Beutler Lab

Gene Symbol

Atrnl1

Ensembl Gene

ENSMUSG00000054843

Gene Name

attractin like 1

Synonyms

Alp

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.203) question?

Stock #

R7718 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57611034-58133338 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 57740183 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 1090 (C1090*)

Ref Sequence

ENSEMBL: ENSMUSP00000076514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077282]

AlphaFold

Q6A051

Predicted Effect

probably null
Transcript: ENSMUST00000077282
AA Change: C1090*

SMART Domains

Protein: ENSMUSP00000076514
Gene: ENSMUSG00000054843
AA Change: C1090*

Domain	Start	End	E-Value	Type
low complexity region	25	32	N/A	INTRINSIC
EGF	61	90	5.71e-1	SMART
CUB	92	208	1.43e-11	SMART
EGF	209	244	1.95e1	SMART
Pfam:EGF_2	248	279	5.8e-7	PFAM
Pfam:Kelch_5	350	391	2.1e-9	PFAM
Pfam:Kelch_6	354	401	5.8e-8	PFAM
Pfam:Kelch_4	465	517	4.3e-7	PFAM
Pfam:Kelch_1	519	573	2.7e-6	PFAM
PSI	613	656	3.38e-1	SMART
PSI	665	708	2e-3	SMART
PSI	714	759	1.72e-2	SMART
CLECT	747	872	2.86e-20	SMART
PSI	888	938	6.26e-5	SMART
PSI	941	1011	1.73e-7	SMART
EGF_Lam	1013	1056	1.07e-5	SMART
low complexity region	1157	1173	N/A	INTRINSIC
transmembrane domain	1229	1251	N/A	INTRINSIC
low complexity region	1261	1272	N/A	INTRINSIC
low complexity region	1326	1339	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (77/78)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit normal coat coloring and normal brain morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	G	A	6: 50,589,098		probably null	Het
9530053A07Rik	T	C	7: 28,147,201	F1106S	probably damaging	Het
A430033K04Rik	A	T	5: 138,647,860	H669L	possibly damaging	Het
A930017K11Rik	T	A	17: 25,947,024	R430*	probably null	Het
Abcb1a	A	T	5: 8,715,788	N700I	probably damaging	Het
Abcc6	T	C	7: 45,977,392	K1414E	possibly damaging	Het
Adcy5	T	C	16: 35,280,415	V779A	probably benign	Het
Agap2	A	G	10: 127,079,865	S82G	possibly damaging	Het
Aldh1l1	A	G	6: 90,598,323	N864S	probably damaging	Het
Ang2	A	T	14: 51,195,760	V55E	probably benign	Het
Ank2	A	G	3: 126,965,013	M179T	possibly damaging	Het
Atxn1l	A	G	8: 109,733,234	L132P	probably damaging	Het
Bptf	A	G	11: 107,081,456	V862A	possibly damaging	Het
Capn11	C	A	17: 45,643,781	K143N	probably damaging	Het
Card6	A	G	15: 5,099,787	V709A	possibly damaging	Het
Cavin4	C	T	4: 48,671,984	A143V	probably benign	Het
Cntn5	A	G	9: 9,984,128	I160T	probably benign	Het
Cyp2c40	T	A	19: 39,767,338	N511Y	probably benign	Het
Dsc2	A	T	18: 20,041,778	I480N	probably damaging	Het
Elf2	G	T	3: 51,265,964		probably benign	Het
Enoph1	T	C	5: 100,062,160	V133A	possibly damaging	Het
Ezh2	A	T	6: 47,554,191	D186E	probably benign	Het
Fam196b	T	C	11: 34,402,539	S194P	probably benign	Het
Gfra1	T	C	19: 58,453,457	D14G	possibly damaging	Het
Gm9573	T	C	17: 35,622,836	T153A	unknown	Het
Gmip	C	T	8: 69,817,733	R698W	probably damaging	Het
Grk4	A	G	5: 34,694,816	N135D	probably benign	Het
Hspb6	A	G	7: 30,554,347	D95G	probably benign	Het
Htatip2	T	G	7: 49,770,884	H159Q	possibly damaging	Het
Igfn1	T	C	1: 135,969,036	E1264G	probably benign	Het
Katnb1	T	A	8: 95,095,208	V223E	possibly damaging	Het
Klra6	AGG	AG	6: 130,013,352		probably null	Het
Masp2	C	T	4: 148,602,747	R29C	probably damaging	Het
Mcm3	A	T	1: 20,817,274	C123*	probably null	Het
Mdn1	T	C	4: 32,718,420	V2225A	probably damaging	Het
Me1	A	G	9: 86,679,900	L44S	probably damaging	Het
Mlxip	A	G	5: 123,445,514	N380S	probably benign	Het
Myh14	C	T	7: 44,661,040	V140I	probably damaging	Het
Myocd	A	T	11: 65,218,626	D106E	probably damaging	Het
Oat	T	C	7: 132,558,259	I411V	probably benign	Het
Olfr1085	A	G	2: 86,658,029	V143A	probably benign	Het
Olfr483	T	C	7: 108,103,648	V113A	probably benign	Het
Olfr715	A	T	7: 107,128,718	V225D	probably damaging	Het
Orc2	A	T	1: 58,480,317	H246Q	possibly damaging	Het
Pank4	A	G	4: 154,974,643	E411G	probably damaging	Het
Patl2	A	T	2: 122,126,774		probably null	Het
Pcdhb15	A	G	18: 37,475,163	N483D	probably damaging	Het
Pcdhb20	A	G	18: 37,505,651	D410G	probably damaging	Het
Pdcl2	A	G	5: 76,317,999	C125R	probably damaging	Het
Peli3	C	G	19: 4,934,556		probably null	Het
Pkd1	A	G	17: 24,586,500	D3313G	probably benign	Het
Plec	A	C	15: 76,177,439	M2766R	probably damaging	Het
Ppargc1a	C	T	5: 51,498,162	V99M	probably damaging	Het
Psg19	G	A	7: 18,792,443	A374V	probably benign	Het
Psmd7	A	T	8: 107,586,629	F54L	possibly damaging	Het
Ptbp2	C	T	3: 119,720,988	G397R	probably null	Het
Ranbp3	A	G	17: 56,696,718	D39G	probably damaging	Het
Rcor3	T	C	1: 192,101,721	T406A	probably benign	Het
Rhbdl2	T	A	4: 123,824,919	I222K	probably damaging	Het
Ripk2	T	C	4: 16,151,968	N197S	possibly damaging	Het
Rpia	A	T	6: 70,766,618	M283K	probably damaging	Het
Rps6kc1	T	C	1: 190,871,825	D200G	probably benign	Het
Sipa1l1	A	T	12: 82,342,497	K499M	probably damaging	Het
Slc5a4b	A	G	10: 76,070,573	L404P	probably damaging	Het
Son	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	16: 91,660,334		probably benign	Het
St7	A	C	6: 17,854,999	T312P	probably damaging	Het
Strbp	T	C	2: 37,625,282	E244G	probably damaging	Het
Tbc1d8	T	G	1: 39,376,980	T871P	probably benign	Het
Tcp1	T	A	17: 12,922,162	I286N	probably damaging	Het
Tead3	C	A	17: 28,333,517	V327F	probably damaging	Het
Tmem132c	A	T	5: 127,563,440	T892S	probably benign	Het
Trmt2a	T	C	16: 18,250,623	S65P	probably benign	Het
Ubp1	A	G	9: 113,973,529	N479S	possibly damaging	Het
Ubtfl1	A	T	9: 18,409,231	L18F	possibly damaging	Het
Uevld	T	G	7: 46,938,056	M299L	probably benign	Het
Unc13b	T	A	4: 43,173,854	Y1561N	unknown	Het
Ylpm1	A	G	12: 85,029,122	K874E	probably damaging	Het
Zbtb37	G	A	1: 161,032,232	R168W	possibly damaging	Het

Other mutations in Atrnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Atrnl1	APN	19	57691817	missense	probably benign	0.02
IGL00707:Atrnl1	APN	19	57673265	missense	probably damaging	0.96
IGL00921:Atrnl1	APN	19	57702153	missense	probably damaging	1.00
IGL01410:Atrnl1	APN	19	58131104	missense	probably damaging	1.00
IGL01468:Atrnl1	APN	19	57699712	missense	probably benign	0.02
IGL01756:Atrnl1	APN	19	57652948	missense	probably benign
IGL01971:Atrnl1	APN	19	57753283	missense	probably damaging	1.00
IGL02019:Atrnl1	APN	19	57691763	splice site	probably benign
IGL02580:Atrnl1	APN	19	57714576	splice site	probably benign
IGL02649:Atrnl1	APN	19	57650441	splice site	probably benign
IGL02676:Atrnl1	APN	19	57691884	missense	probably damaging	1.00
IGL03276:Atrnl1	APN	19	57652927	missense	probably damaging	0.99
IGL03379:Atrnl1	APN	19	57642541	missense	probably benign	0.02
Magnetogorsk	UTSW	19	57630306	missense	probably damaging	1.00
polar	UTSW	19	57652950	missense	probably benign	0.00
PIT4812001:Atrnl1	UTSW	19	57731623	missense	probably benign	0.08
R0109:Atrnl1	UTSW	19	57755517	missense	possibly damaging	0.78
R0308:Atrnl1	UTSW	19	57753288	missense	probably benign	0.04
R0394:Atrnl1	UTSW	19	57673176	missense	probably benign	0.10
R0734:Atrnl1	UTSW	19	57654861	missense	probably damaging	1.00
R0811:Atrnl1	UTSW	19	57673141	missense	probably benign	0.07
R0812:Atrnl1	UTSW	19	57673141	missense	probably benign	0.07
R1183:Atrnl1	UTSW	19	57650293	missense	probably damaging	0.97
R1213:Atrnl1	UTSW	19	57638462	missense	probably benign	0.25
R1344:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1418:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1707:Atrnl1	UTSW	19	57686737	missense	probably benign	0.00
R1748:Atrnl1	UTSW	19	57714702	missense	probably damaging	0.99
R2051:Atrnl1	UTSW	19	57691849	missense	probably benign	0.01
R2113:Atrnl1	UTSW	19	57755616	nonsense	probably null
R2130:Atrnl1	UTSW	19	57654994	missense	probably damaging	1.00
R3710:Atrnl1	UTSW	19	57657114	missense	probably damaging	1.00
R3916:Atrnl1	UTSW	19	57935652	missense	possibly damaging	0.82
R4524:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R4707:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4712:Atrnl1	UTSW	19	57652950	missense	probably benign	0.00
R4784:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4785:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4798:Atrnl1	UTSW	19	58042361	missense	probably benign
R5172:Atrnl1	UTSW	19	57685513	nonsense	probably null
R5226:Atrnl1	UTSW	19	57650335	missense	probably benign
R5289:Atrnl1	UTSW	19	57657082	missense	probably damaging	1.00
R5372:Atrnl1	UTSW	19	57755536	missense	probably benign
R5737:Atrnl1	UTSW	19	57777888	missense	possibly damaging	0.84
R5782:Atrnl1	UTSW	19	57753286	missense	possibly damaging	0.95
R5826:Atrnl1	UTSW	19	57630292	nonsense	probably null
R6169:Atrnl1	UTSW	19	57642463	missense	probably benign	0.00
R6242:Atrnl1	UTSW	19	57642478	missense	probably benign	0.02
R6342:Atrnl1	UTSW	19	57638510	missense	probably damaging	1.00
R6372:Atrnl1	UTSW	19	57650332	missense	probably benign	0.01
R6811:Atrnl1	UTSW	19	57654961	missense	probably damaging	0.98
R6897:Atrnl1	UTSW	19	58042368	missense	probably benign	0.01
R7024:Atrnl1	UTSW	19	57638450	critical splice acceptor site	probably null
R7085:Atrnl1	UTSW	19	57691857	missense	probably damaging	1.00
R7144:Atrnl1	UTSW	19	58042352	missense	probably damaging	1.00
R7259:Atrnl1	UTSW	19	57935606	nonsense	probably null
R7289:Atrnl1	UTSW	19	57650414	missense	probably benign	0.13
R7310:Atrnl1	UTSW	19	57642424	missense	possibly damaging	0.69
R7372:Atrnl1	UTSW	19	57935646	missense	possibly damaging	0.47
R7432:Atrnl1	UTSW	19	57755524	missense	probably damaging	1.00
R7478:Atrnl1	UTSW	19	57696312	missense	possibly damaging	0.89
R7556:Atrnl1	UTSW	19	57654846	missense	probably benign
R7567:Atrnl1	UTSW	19	57699523	missense	probably damaging	0.98
R7608:Atrnl1	UTSW	19	57714687	missense	probably damaging	1.00
R7632:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R7655:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7656:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7721:Atrnl1	UTSW	19	57696331	missense	probably benign	0.00
R7726:Atrnl1	UTSW	19	57702072	missense	probably damaging	1.00
R7733:Atrnl1	UTSW	19	57701988	missense	probably benign	0.00
R7774:Atrnl1	UTSW	19	57699671	missense	probably damaging	1.00
R8010:Atrnl1	UTSW	19	57682446	missense	probably benign	0.14
R8119:Atrnl1	UTSW	19	57642463	missense	probably benign	0.00
R9242:Atrnl1	UTSW	19	57657228	missense	probably benign	0.07
R9265:Atrnl1	UTSW	19	57777927	missense	probably benign	0.11
R9272:Atrnl1	UTSW	19	57654988	missense	probably benign	0.00
R9480:Atrnl1	UTSW	19	57701988	missense	possibly damaging	0.61
R9526:Atrnl1	UTSW	19	57629119	missense	probably damaging	0.99
R9672:Atrnl1	UTSW	19	57630263	missense	possibly damaging	0.87
R9673:Atrnl1	UTSW	19	57611354	start codon destroyed	probably null	0.04
RF021:Atrnl1	UTSW	19	57642473	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTCCTGGATACGGCCTTTTCAC -3'
(R):5'- CTTAGCAACAGATGTGGAAGTG -3'

Sequencing Primer
(F):5'- GGGTTTCTGCAGTCAGTTA -3'
(R):5'- GGCTGGCCTTGAACTCAGAAATC -3'

Posted On

2019-11-12