Incidental Mutation 'R7719:Igsf3'
ID595096
Institutional Source Beutler Lab
Gene Symbol Igsf3
Ensembl Gene ENSMUSG00000042035
Gene Nameimmunoglobulin superfamily, member 3
Synonyms1700016K10Rik, 4833439O17Rik, 2810035F16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R7719 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location101377083-101463059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101435541 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 478 (R478H)
Ref Sequence ENSEMBL: ENSMUSP00000048900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043983] [ENSMUST00000195164]
Predicted Effect probably damaging
Transcript: ENSMUST00000043983
AA Change: R478H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048900
Gene: ENSMUSG00000042035
AA Change: R478H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 142 7.7e-5 SMART
IG 152 275 1.99e-7 SMART
IG 287 405 1.79e0 SMART
IG 417 539 6.26e-5 SMART
IG 553 674 3.16e-1 SMART
IG 686 811 4.89e-7 SMART
IG 823 947 8.38e-6 SMART
IG 959 1109 6.97e-3 SMART
transmembrane domain 1125 1147 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195164
AA Change: R498H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141823
Gene: ENSMUSG00000042035
AA Change: R498H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 142 3.1e-7 SMART
IG 152 275 8.2e-10 SMART
IG 287 405 7.4e-3 SMART
IG 437 559 2.5e-7 SMART
IG 573 694 1.3e-3 SMART
IG 706 831 1.9e-9 SMART
IG 843 967 3.4e-8 SMART
IG 979 1129 2.9e-5 SMART
transmembrane domain 1145 1167 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an immunoglobulin-like membrane protein containing several V-type Ig-like domains. A mutation in this gene has been associated with bilateral nasolacrimal duct obstruction (LCDD). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,327,355 I633T probably benign Het
Acbd6 T A 1: 155,687,012 L253H probably damaging Het
Adam11 T C 11: 102,772,477 V238A probably benign Het
Amer3 A T 1: 34,589,002 H774L possibly damaging Het
Anapc15 T C 7: 101,901,029 L150P unknown Het
Ano8 G T 8: 71,483,140 T278K possibly damaging Het
Atg16l2 T C 7: 101,289,867 K618E probably damaging Het
Casz1 C T 4: 148,944,524 S1142L probably damaging Het
Ccdc30 T A 4: 119,333,616 E471D probably damaging Het
Cks1b T C 3: 89,416,328 N45D probably benign Het
Clasrp T C 7: 19,587,844 T296A probably damaging Het
Cluap1 C T 16: 3,909,603 probably null Het
Cntn5 T A 9: 9,704,898 D632V probably damaging Het
Cntnap3 G A 13: 64,772,777 Q593* probably null Het
Col18a1 A T 10: 77,078,012 I457K probably benign Het
Crybb3 G T 5: 113,075,968 Q192K probably damaging Het
Cyb561d2 C T 9: 107,540,184 A123T probably benign Het
Cyp2b13 C T 7: 26,095,670 A442V probably damaging Het
Cyp2j9 G A 4: 96,568,842 T464I probably benign Het
Cyp4a29 G A 4: 115,250,940 G320R possibly damaging Het
Dbp T C 7: 45,709,750 I283T probably damaging Het
Efcab3 T C 11: 105,111,848 I303T probably benign Het
Efcab8 T A 2: 153,787,745 V166D Het
Efhc1 A T 1: 20,979,520 I535F probably benign Het
Epb41l3 A G 17: 69,253,414 I319V possibly damaging Het
Ewsr1 T C 11: 5,085,900 T193A unknown Het
Fam227a T C 15: 79,620,712 N510S possibly damaging Het
Frmpd1 T C 4: 45,284,841 C1221R possibly damaging Het
Gm6741 A C 17: 91,237,044 E78D probably benign Het
Gpam C T 19: 55,081,670 V385I probably damaging Het
Gpr55 A G 1: 85,941,337 V174A probably benign Het
Gsdmc T C 15: 63,778,964 probably null Het
Hmcn1 T A 1: 150,565,329 D5509V possibly damaging Het
Hoxc13 A T 15: 102,921,858 Q224L possibly damaging Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Itgb5 A G 16: 33,920,116 Q532R probably benign Het
Jph1 T C 1: 17,091,991 Y149C probably damaging Het
Lztfl1 T C 9: 123,715,330 D33G probably null Het
Mex3c G T 18: 73,589,990 A385S possibly damaging Het
Myo5a T A 9: 75,144,084 S320T probably benign Het
Nsun4 A T 4: 116,052,420 N314K possibly damaging Het
Olfr1271 A T 2: 90,266,259 M57K probably damaging Het
Omg T A 11: 79,502,233 E266D probably benign Het
Paqr9 T A 9: 95,560,776 V273E possibly damaging Het
Phkg1 G A 5: 129,873,858 probably benign Het
Plekhm3 T C 1: 64,921,742 K452E probably benign Het
Plpbp T A 8: 27,045,946 I86N Het
Prl2c1 G T 13: 27,851,797 A51S probably damaging Het
Prmt8 A T 6: 127,729,503 H108Q probably damaging Het
Prrc2b T A 2: 32,217,268 C1614* probably null Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Rassf9 A G 10: 102,545,600 D281G probably benign Het
Rmnd1 T C 10: 4,427,496 D61G probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Ryr2 A G 13: 11,730,343 S2055P possibly damaging Het
Six5 G A 7: 19,096,878 A477T probably damaging Het
Speg A G 1: 75,375,825 E129G probably damaging Het
Stard10 C T 7: 101,346,113 A78V not run Het
Stard3 T C 11: 98,375,676 V127A probably benign Het
Svep1 G A 4: 58,068,523 P3088S probably damaging Het
Tbck A G 3: 132,734,728 D508G probably damaging Het
Tgm2 T A 2: 158,143,118 T23S probably damaging Het
Ttll10 G T 4: 156,047,208 probably null Het
Vcan A T 13: 89,704,619 S741T probably damaging Het
Vmn2r13 T C 5: 109,171,752 N454S probably benign Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Wnt8a T C 18: 34,547,535 W318R probably damaging Het
Zer1 A T 2: 30,111,231 L87H probably damaging Het
Zfp518a T A 19: 40,912,768 N380K probably benign Het
Zfp90 T C 8: 106,419,093 V19A probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Igsf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Igsf3 APN 3 101431239 missense probably damaging 0.99
IGL00907:Igsf3 APN 3 101427448 splice site probably benign
IGL01321:Igsf3 APN 3 101427022 splice site probably benign
IGL01340:Igsf3 APN 3 101439679 nonsense probably null
IGL02291:Igsf3 APN 3 101439529 missense probably damaging 1.00
PIT4402001:Igsf3 UTSW 3 101427077 missense probably benign 0.00
R0090:Igsf3 UTSW 3 101435652 missense probably damaging 1.00
R0143:Igsf3 UTSW 3 101435601 missense probably damaging 1.00
R0418:Igsf3 UTSW 3 101435435 missense probably damaging 0.99
R0711:Igsf3 UTSW 3 101427393 missense probably benign 0.31
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1384:Igsf3 UTSW 3 101451296 critical splice donor site probably null
R1594:Igsf3 UTSW 3 101451077 nonsense probably null
R1624:Igsf3 UTSW 3 101455227 missense probably benign 0.37
R1766:Igsf3 UTSW 3 101431282 missense probably damaging 1.00
R1988:Igsf3 UTSW 3 101431296 missense probably benign 0.03
R2072:Igsf3 UTSW 3 101439515 missense probably benign 0.02
R4707:Igsf3 UTSW 3 101458094 missense probably benign 0.06
R4976:Igsf3 UTSW 3 101439361 splice site probably null
R4982:Igsf3 UTSW 3 101435667 missense probably benign 0.42
R5008:Igsf3 UTSW 3 101450917 missense probably damaging 0.97
R5119:Igsf3 UTSW 3 101439361 splice site probably null
R5189:Igsf3 UTSW 3 101431527 missense possibly damaging 0.64
R5456:Igsf3 UTSW 3 101427221 missense probably benign 0.20
R5776:Igsf3 UTSW 3 101425480 missense probably benign 0.01
R6112:Igsf3 UTSW 3 101451006 missense probably damaging 1.00
R6383:Igsf3 UTSW 3 101435648 missense probably benign 0.05
R6758:Igsf3 UTSW 3 101425498 missense probably damaging 0.98
R7085:Igsf3 UTSW 3 101455489 missense probably benign 0.12
R7310:Igsf3 UTSW 3 101431579 missense probably benign 0.01
R7470:Igsf3 UTSW 3 101451075 missense possibly damaging 0.67
R7707:Igsf3 UTSW 3 101459922 missense probably benign 0.00
R7739:Igsf3 UTSW 3 101435531 missense probably damaging 1.00
R8115:Igsf3 UTSW 3 101455279 missense probably benign 0.01
R8128:Igsf3 UTSW 3 101439631 missense probably damaging 1.00
R8221:Igsf3 UTSW 3 101439722 missense probably damaging 1.00
X0027:Igsf3 UTSW 3 101435645 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCAGCATCTCCGTGGAG -3'
(R):5'- CAAGGGCTGTGATAGAGACC -3'

Sequencing Primer
(F):5'- CAATGCCAGTGTCGTCCTTGAG -3'
(R):5'- CTGTGATAGAGACCAGGGTACTG -3'
Posted On2019-11-12