Incidental Mutation 'R7719:Frmpd1'
ID595098
Institutional Source Beutler Lab
Gene Symbol Frmpd1
Ensembl Gene ENSMUSG00000035615
Gene NameFERM and PDZ domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7719 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location45184875-45285936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45284841 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 1221 (C1221R)
Ref Sequence ENSEMBL: ENSMUSP00000047232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044773] [ENSMUST00000107804]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044773
AA Change: C1221R

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047232
Gene: ENSMUSG00000035615
AA Change: C1221R

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000107804
AA Change: C1221R

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103434
Gene: ENSMUSG00000035615
AA Change: C1221R

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,327,355 I633T probably benign Het
Acbd6 T A 1: 155,687,012 L253H probably damaging Het
Adam11 T C 11: 102,772,477 V238A probably benign Het
Amer3 A T 1: 34,589,002 H774L possibly damaging Het
Anapc15 T C 7: 101,901,029 L150P unknown Het
Ano8 G T 8: 71,483,140 T278K possibly damaging Het
Atg16l2 T C 7: 101,289,867 K618E probably damaging Het
Casz1 C T 4: 148,944,524 S1142L probably damaging Het
Ccdc30 T A 4: 119,333,616 E471D probably damaging Het
Cks1b T C 3: 89,416,328 N45D probably benign Het
Clasrp T C 7: 19,587,844 T296A probably damaging Het
Cntn5 T A 9: 9,704,898 D632V probably damaging Het
Cntnap3 G A 13: 64,772,777 Q593* probably null Het
Col18a1 A T 10: 77,078,012 I457K probably benign Het
Crybb3 G T 5: 113,075,968 Q192K probably damaging Het
Cyb561d2 C T 9: 107,540,184 A123T probably benign Het
Cyp2b13 C T 7: 26,095,670 A442V probably damaging Het
Cyp2j9 G A 4: 96,568,842 T464I probably benign Het
Cyp4a29 G A 4: 115,250,940 G320R possibly damaging Het
Dbp T C 7: 45,709,750 I283T probably damaging Het
Efcab3 T C 11: 105,111,848 I303T probably benign Het
Efcab8 T A 2: 153,787,745 V166D Het
Efhc1 A T 1: 20,979,520 I535F probably benign Het
Epb41l3 A G 17: 69,253,414 I319V possibly damaging Het
Ewsr1 T C 11: 5,085,900 T193A unknown Het
Fam227a T C 15: 79,620,712 N510S possibly damaging Het
Gm6741 A C 17: 91,237,044 E78D probably benign Het
Gpam C T 19: 55,081,670 V385I probably damaging Het
Gpr55 A G 1: 85,941,337 V174A probably benign Het
Hmcn1 T A 1: 150,565,329 D5509V possibly damaging Het
Hoxc13 A T 15: 102,921,858 Q224L possibly damaging Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Igsf3 G A 3: 101,435,541 R478H probably damaging Het
Itgb5 A G 16: 33,920,116 Q532R probably benign Het
Jph1 T C 1: 17,091,991 Y149C probably damaging Het
Lztfl1 T C 9: 123,715,330 D33G probably null Het
Mex3c G T 18: 73,589,990 A385S possibly damaging Het
Myo5a T A 9: 75,144,084 S320T probably benign Het
Nsun4 A T 4: 116,052,420 N314K possibly damaging Het
Olfr1271 A T 2: 90,266,259 M57K probably damaging Het
Omg T A 11: 79,502,233 E266D probably benign Het
Paqr9 T A 9: 95,560,776 V273E possibly damaging Het
Phkg1 G A 5: 129,873,858 probably benign Het
Plekhm3 T C 1: 64,921,742 K452E probably benign Het
Plpbp T A 8: 27,045,946 I86N Het
Prl2c1 G T 13: 27,851,797 A51S probably damaging Het
Prmt8 A T 6: 127,729,503 H108Q probably damaging Het
Prrc2b T A 2: 32,217,268 C1614* probably null Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Rassf9 A G 10: 102,545,600 D281G probably benign Het
Rmnd1 T C 10: 4,427,496 D61G probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Ryr2 A G 13: 11,730,343 S2055P possibly damaging Het
Six5 G A 7: 19,096,878 A477T probably damaging Het
Speg A G 1: 75,375,825 E129G probably damaging Het
Stard10 C T 7: 101,346,113 A78V not run Het
Stard3 T C 11: 98,375,676 V127A probably benign Het
Svep1 G A 4: 58,068,523 P3088S probably damaging Het
Tbck A G 3: 132,734,728 D508G probably damaging Het
Tgm2 T A 2: 158,143,118 T23S probably damaging Het
Vcan A T 13: 89,704,619 S741T probably damaging Het
Vmn2r13 T C 5: 109,171,752 N454S probably benign Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Wnt8a T C 18: 34,547,535 W318R probably damaging Het
Zer1 A T 2: 30,111,231 L87H probably damaging Het
Zfp518a T A 19: 40,912,768 N380K probably benign Het
Zfp90 T C 8: 106,419,093 V19A probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Frmpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Frmpd1 APN 4 45279456 missense possibly damaging 0.61
IGL01678:Frmpd1 APN 4 45243717 missense probably damaging 1.00
IGL01815:Frmpd1 APN 4 45284239 missense probably benign
IGL02305:Frmpd1 APN 4 45249209 missense probably damaging 1.00
IGL02347:Frmpd1 APN 4 45270023 splice site probably null
IGL02586:Frmpd1 APN 4 45285160 missense probably damaging 1.00
IGL02704:Frmpd1 APN 4 45285082 missense possibly damaging 0.83
IGL02942:Frmpd1 APN 4 45285493 missense probably damaging 0.99
IGL03353:Frmpd1 APN 4 45261926 missense probably damaging 1.00
IGL03355:Frmpd1 APN 4 45279140 missense probably damaging 1.00
IGL03401:Frmpd1 APN 4 45284383 missense probably benign 0.28
IGL03047:Frmpd1 UTSW 4 45283993 missense probably damaging 1.00
R0094:Frmpd1 UTSW 4 45284899 nonsense probably null
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0375:Frmpd1 UTSW 4 45284196 missense probably benign 0.00
R0508:Frmpd1 UTSW 4 45284938 missense unknown
R0524:Frmpd1 UTSW 4 45256902 missense probably damaging 1.00
R0524:Frmpd1 UTSW 4 45283774 missense probably benign 0.00
R0625:Frmpd1 UTSW 4 45284055 missense probably benign
R0825:Frmpd1 UTSW 4 45285394 missense possibly damaging 0.93
R0926:Frmpd1 UTSW 4 45268497 missense probably damaging 1.00
R0975:Frmpd1 UTSW 4 45279000 missense probably benign 0.01
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1573:Frmpd1 UTSW 4 45283932 missense probably benign 0.01
R1938:Frmpd1 UTSW 4 45283711 missense probably damaging 1.00
R2334:Frmpd1 UTSW 4 45285408 missense probably damaging 0.97
R2413:Frmpd1 UTSW 4 45278969 missense probably benign 0.02
R2760:Frmpd1 UTSW 4 45244667 missense possibly damaging 0.77
R3856:Frmpd1 UTSW 4 45283698 missense probably damaging 1.00
R3876:Frmpd1 UTSW 4 45284093 missense probably benign 0.01
R4080:Frmpd1 UTSW 4 45284382 missense probably benign
R4597:Frmpd1 UTSW 4 45274441 missense probably benign 0.12
R4714:Frmpd1 UTSW 4 45284785 missense probably benign 0.11
R4779:Frmpd1 UTSW 4 45229865 missense probably damaging 1.00
R4957:Frmpd1 UTSW 4 45273099 missense probably damaging 1.00
R5000:Frmpd1 UTSW 4 45261931 splice site probably null
R5041:Frmpd1 UTSW 4 45278878 missense probably damaging 1.00
R5228:Frmpd1 UTSW 4 45284322 missense probably damaging 0.98
R5413:Frmpd1 UTSW 4 45249196 missense probably benign 0.00
R5560:Frmpd1 UTSW 4 45243697 missense probably damaging 1.00
R6133:Frmpd1 UTSW 4 45284915 missense probably benign 0.01
R6158:Frmpd1 UTSW 4 45285401 missense probably damaging 1.00
R6329:Frmpd1 UTSW 4 45268551 missense possibly damaging 0.80
R6338:Frmpd1 UTSW 4 45274489 missense probably benign 0.00
R6544:Frmpd1 UTSW 4 45279024 missense probably damaging 1.00
R6728:Frmpd1 UTSW 4 45284664 missense probably benign
R6748:Frmpd1 UTSW 4 45274397 missense probably benign 0.08
R6798:Frmpd1 UTSW 4 45284850 missense probably benign 0.17
R6828:Frmpd1 UTSW 4 45275383 missense probably damaging 0.99
R7002:Frmpd1 UTSW 4 45284200 missense probably benign
R7258:Frmpd1 UTSW 4 45269974 missense possibly damaging 0.79
R7295:Frmpd1 UTSW 4 45285700 missense probably damaging 1.00
R7382:Frmpd1 UTSW 4 45278880 missense probably benign 0.00
R7423:Frmpd1 UTSW 4 45256948 missense probably damaging 1.00
R7451:Frmpd1 UTSW 4 45279558 missense probably benign 0.11
R7492:Frmpd1 UTSW 4 45285237 missense possibly damaging 0.71
R7524:Frmpd1 UTSW 4 45271181 missense probably benign 0.16
R7610:Frmpd1 UTSW 4 45279098 missense probably damaging 1.00
R7724:Frmpd1 UTSW 4 45229888 missense probably damaging 1.00
Z1088:Frmpd1 UTSW 4 45284080 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CATCTGACTCTGAAGGGGAAAAC -3'
(R):5'- TCGTTTATGCCAGCAAAACTG -3'

Sequencing Primer
(F):5'- ACAGAGAGGCCCAGGAAC -3'
(R):5'- CTGAGACTGGTGGAGCCTTC -3'
Posted On2019-11-12