Incidental Mutation 'R7719:Vmn2r13'
ID595105
Institutional Source Beutler Lab
Gene Symbol Vmn2r13
Ensembl Gene ENSMUSG00000091635
Gene Namevomeronasal 2, receptor 13
SynonymsGm4867
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7719 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location109156068-109192107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109171752 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 454 (N454S)
Ref Sequence ENSEMBL: ENSMUSP00000052977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053253]
Predicted Effect probably benign
Transcript: ENSMUST00000053253
AA Change: N454S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000052977
Gene: ENSMUSG00000091635
AA Change: N454S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 76 463 2.8e-29 PFAM
Pfam:NCD3G 506 560 1.3e-18 PFAM
Pfam:7tm_3 593 828 1.8e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,327,355 I633T probably benign Het
Acbd6 T A 1: 155,687,012 L253H probably damaging Het
Adam11 T C 11: 102,772,477 V238A probably benign Het
Amer3 A T 1: 34,589,002 H774L possibly damaging Het
Anapc15 T C 7: 101,901,029 L150P unknown Het
Ano8 G T 8: 71,483,140 T278K possibly damaging Het
Atg16l2 T C 7: 101,289,867 K618E probably damaging Het
Casz1 C T 4: 148,944,524 S1142L probably damaging Het
Ccdc30 T A 4: 119,333,616 E471D probably damaging Het
Cks1b T C 3: 89,416,328 N45D probably benign Het
Clasrp T C 7: 19,587,844 T296A probably damaging Het
Cluap1 C T 16: 3,909,603 probably null Het
Cntn5 T A 9: 9,704,898 D632V probably damaging Het
Cntnap3 G A 13: 64,772,777 Q593* probably null Het
Col18a1 A T 10: 77,078,012 I457K probably benign Het
Crybb3 G T 5: 113,075,968 Q192K probably damaging Het
Cyb561d2 C T 9: 107,540,184 A123T probably benign Het
Cyp2b13 C T 7: 26,095,670 A442V probably damaging Het
Cyp2j9 G A 4: 96,568,842 T464I probably benign Het
Cyp4a29 G A 4: 115,250,940 G320R possibly damaging Het
Dbp T C 7: 45,709,750 I283T probably damaging Het
Efcab3 T C 11: 105,111,848 I303T probably benign Het
Efcab8 T A 2: 153,787,745 V166D Het
Efhc1 A T 1: 20,979,520 I535F probably benign Het
Epb41l3 A G 17: 69,253,414 I319V possibly damaging Het
Ewsr1 T C 11: 5,085,900 T193A unknown Het
Fam227a T C 15: 79,620,712 N510S possibly damaging Het
Frmpd1 T C 4: 45,284,841 C1221R possibly damaging Het
Gm6741 A C 17: 91,237,044 E78D probably benign Het
Gpam C T 19: 55,081,670 V385I probably damaging Het
Gpr55 A G 1: 85,941,337 V174A probably benign Het
Gsdmc T C 15: 63,778,964 probably null Het
Hmcn1 T A 1: 150,565,329 D5509V possibly damaging Het
Hoxc13 A T 15: 102,921,858 Q224L possibly damaging Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Igsf3 G A 3: 101,435,541 R478H probably damaging Het
Itgb5 A G 16: 33,920,116 Q532R probably benign Het
Jph1 T C 1: 17,091,991 Y149C probably damaging Het
Lztfl1 T C 9: 123,715,330 D33G probably null Het
Mex3c G T 18: 73,589,990 A385S possibly damaging Het
Myo5a T A 9: 75,144,084 S320T probably benign Het
Nsun4 A T 4: 116,052,420 N314K possibly damaging Het
Olfr1271 A T 2: 90,266,259 M57K probably damaging Het
Omg T A 11: 79,502,233 E266D probably benign Het
Paqr9 T A 9: 95,560,776 V273E possibly damaging Het
Phkg1 G A 5: 129,873,858 probably benign Het
Plekhm3 T C 1: 64,921,742 K452E probably benign Het
Plpbp T A 8: 27,045,946 I86N Het
Prl2c1 G T 13: 27,851,797 A51S probably damaging Het
Prmt8 A T 6: 127,729,503 H108Q probably damaging Het
Prrc2b T A 2: 32,217,268 C1614* probably null Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Rassf9 A G 10: 102,545,600 D281G probably benign Het
Rmnd1 T C 10: 4,427,496 D61G probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Ryr2 A G 13: 11,730,343 S2055P possibly damaging Het
Six5 G A 7: 19,096,878 A477T probably damaging Het
Speg A G 1: 75,375,825 E129G probably damaging Het
Stard10 C T 7: 101,346,113 A78V not run Het
Stard3 T C 11: 98,375,676 V127A probably benign Het
Svep1 G A 4: 58,068,523 P3088S probably damaging Het
Tbck A G 3: 132,734,728 D508G probably damaging Het
Tgm2 T A 2: 158,143,118 T23S probably damaging Het
Ttll10 G T 4: 156,047,208 probably null Het
Vcan A T 13: 89,704,619 S741T probably damaging Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Wnt8a T C 18: 34,547,535 W318R probably damaging Het
Zer1 A T 2: 30,111,231 L87H probably damaging Het
Zfp518a T A 19: 40,912,768 N380K probably benign Het
Zfp90 T C 8: 106,419,093 V19A probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Vmn2r13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Vmn2r13 APN 5 109156098 missense probably damaging 1.00
IGL01373:Vmn2r13 APN 5 109156702 missense probably damaging 1.00
IGL01946:Vmn2r13 APN 5 109174219 missense probably benign 0.01
IGL01971:Vmn2r13 APN 5 109174115 missense probably benign 0.01
IGL02636:Vmn2r13 APN 5 109192017 missense probably damaging 0.98
IGL03062:Vmn2r13 APN 5 109156282 missense probably damaging 1.00
IGL03173:Vmn2r13 APN 5 109171779 missense possibly damaging 0.95
IGL03301:Vmn2r13 APN 5 109158089 missense probably damaging 0.99
IGL03383:Vmn2r13 APN 5 109156532 missense probably damaging 0.98
IGL03048:Vmn2r13 UTSW 5 109156285 missense probably damaging 1.00
R0123:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0134:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0220:Vmn2r13 UTSW 5 109156466 missense probably damaging 1.00
R0225:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0393:Vmn2r13 UTSW 5 109156529 missense probably benign 0.01
R0410:Vmn2r13 UTSW 5 109173813 missense probably benign 0.35
R0787:Vmn2r13 UTSW 5 109156847 missense probably damaging 0.99
R1200:Vmn2r13 UTSW 5 109174202 missense probably damaging 1.00
R1448:Vmn2r13 UTSW 5 109174135 missense probably damaging 1.00
R1782:Vmn2r13 UTSW 5 109158174 missense probably benign 0.08
R1939:Vmn2r13 UTSW 5 109191986 missense possibly damaging 0.88
R2029:Vmn2r13 UTSW 5 109192077 missense probably benign 0.13
R2125:Vmn2r13 UTSW 5 109158192 missense probably benign 0.00
R2126:Vmn2r13 UTSW 5 109158192 missense probably benign 0.00
R2379:Vmn2r13 UTSW 5 109171778 missense probably benign 0.05
R2680:Vmn2r13 UTSW 5 109174312 missense possibly damaging 0.66
R2888:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R2889:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R2890:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R3014:Vmn2r13 UTSW 5 109171761 missense possibly damaging 0.81
R3683:Vmn2r13 UTSW 5 109156855 missense probably damaging 1.00
R4074:Vmn2r13 UTSW 5 109156700 missense probably damaging 1.00
R4599:Vmn2r13 UTSW 5 109156456 missense probably damaging 1.00
R4614:Vmn2r13 UTSW 5 109175199 missense probably benign 0.01
R4805:Vmn2r13 UTSW 5 109156465 missense probably damaging 1.00
R4822:Vmn2r13 UTSW 5 109174072 missense probably damaging 0.99
R4943:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R5263:Vmn2r13 UTSW 5 109173975 missense probably benign 0.00
R5297:Vmn2r13 UTSW 5 109191939 missense probably benign 0.00
R5502:Vmn2r13 UTSW 5 109173714 missense probably damaging 1.00
R5554:Vmn2r13 UTSW 5 109191994 missense possibly damaging 0.49
R5563:Vmn2r13 UTSW 5 109173980 missense probably benign 0.00
R5819:Vmn2r13 UTSW 5 109174100 missense possibly damaging 0.79
R6074:Vmn2r13 UTSW 5 109174301 missense probably benign 0.04
R6416:Vmn2r13 UTSW 5 109174116 missense probably damaging 0.99
R6419:Vmn2r13 UTSW 5 109175219 missense possibly damaging 0.87
R6484:Vmn2r13 UTSW 5 109156674 nonsense probably null
R6486:Vmn2r13 UTSW 5 109156559 missense probably benign 0.05
R6545:Vmn2r13 UTSW 5 109156940 splice site probably null
R6700:Vmn2r13 UTSW 5 109175072 missense probably benign 0.00
R6897:Vmn2r13 UTSW 5 109158149 missense possibly damaging 0.90
R6957:Vmn2r13 UTSW 5 109156887 nonsense probably null
R7276:Vmn2r13 UTSW 5 109173779 missense probably damaging 1.00
R7363:Vmn2r13 UTSW 5 109192043 missense probably benign 0.03
R7443:Vmn2r13 UTSW 5 109192043 missense probably benign 0.03
R7555:Vmn2r13 UTSW 5 109171691 synonymous probably null
R7607:Vmn2r13 UTSW 5 109173640 missense probably damaging 0.98
X0066:Vmn2r13 UTSW 5 109156219 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CCAGAATTATTACTCATGTGCCTC -3'
(R):5'- GAGGGATTACTTTAATACAGCTGTC -3'

Sequencing Primer
(F):5'- GTTGACTCTGGTGGAAAC -3'
(R):5'- AAAGCATCTCACTTAGGTG -3'
Posted On2019-11-12