Incidental Mutation 'R0241:Cadps'
ID59512
Institutional Source Beutler Lab
Gene Symbol Cadps
Ensembl Gene ENSMUSG00000054423
Gene NameCa2+-dependent secretion activator
SynonymsCAPS1
MMRRC Submission 038479-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0241 (G1)
Quality Score129
Status Validated
Chromosome14
Chromosomal Location12372563-12823079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12376675 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1274 (T1274M)
Ref Sequence ENSEMBL: ENSMUSP00000136076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067491] [ENSMUST00000112657] [ENSMUST00000112658] [ENSMUST00000177814] [ENSMUST00000224882]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067491
AA Change: T1279M

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000064706
Gene: ENSMUSG00000054423
AA Change: T1279M

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 772 783 N/A INTRINSIC
DUF1041 833 948 6.21e-54 SMART
low complexity region 1022 1045 N/A INTRINSIC
low complexity region 1354 1361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112657
AA Change: T1272M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108276
Gene: ENSMUSG00000054423
AA Change: T1272M

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 775 786 N/A INTRINSIC
DUF1041 836 941 3.88e-55 SMART
low complexity region 1015 1038 N/A INTRINSIC
low complexity region 1347 1354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112658
AA Change: T1273M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108277
Gene: ENSMUSG00000054423
AA Change: T1273M

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 776 787 N/A INTRINSIC
DUF1041 837 942 3.88e-55 SMART
low complexity region 1016 1039 N/A INTRINSIC
low complexity region 1348 1355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177814
AA Change: T1274M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136076
Gene: ENSMUSG00000054423
AA Change: T1274M

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 777 788 N/A INTRINSIC
DUF1041 838 943 2.75e-55 SMART
low complexity region 1017 1040 N/A INTRINSIC
low complexity region 1349 1356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224140
Predicted Effect probably benign
Transcript: ENSMUST00000224581
Predicted Effect probably benign
Transcript: ENSMUST00000224882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225807
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel neural/endocrine-specific cytosolic and peripheral membrane protein required for the Ca2+-regulated exocytosis of secretory vesicles. The protein acts at a stage in exocytosis that follows ATP-dependent priming, which involves the essential synthesis of phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Alternative splicing has been observed at this locus and three variants, encoding distinct isoforms, are described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, respiratory failure and abnormal adrenal gland physiology. Adult heterozygous null mice display abnormal adrenal gland physiology that is different from that seen in homozygous neonates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck2 T A 6: 39,583,818 V380E probably benign Het
Anapc1 A T 2: 128,628,629 M1527K possibly damaging Het
Arfgef3 T A 10: 18,599,214 I1575F probably damaging Het
Atp4a G T 7: 30,717,135 G446C probably benign Het
Bicra A T 7: 15,975,145 M1188K probably damaging Het
Brd7 G A 8: 88,345,850 R331W probably benign Het
Cactin A G 10: 81,322,652 T151A probably benign Het
Catsper3 T C 13: 55,804,854 M175T probably damaging Het
Chd5 A G 4: 152,366,132 D605G probably damaging Het
Chst12 G A 5: 140,524,299 R227H possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cobl A T 11: 12,254,524 V644E probably benign Het
Ddx31 A G 2: 28,848,291 T155A probably damaging Het
Dnah3 T C 7: 119,922,730 Q4069R probably damaging Het
Dnah8 T C 17: 30,765,679 I3117T probably damaging Het
Doc2b A G 11: 75,772,561 V355A probably damaging Het
Dock10 A T 1: 80,578,623 S578T probably benign Het
Duox1 T C 2: 122,333,397 probably benign Het
Epb41l5 T C 1: 119,567,779 probably null Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fcer2a A G 8: 3,688,796 probably null Het
Fmnl1 G A 11: 103,182,170 probably null Het
Fry A T 5: 150,260,346 probably benign Het
Git2 T C 5: 114,733,229 E208G probably damaging Het
Gm13757 A T 2: 88,446,545 M131K possibly damaging Het
Hs6st3 T C 14: 119,138,820 F136L probably benign Het
Hydin G A 8: 110,398,023 V555I probably benign Het
Kcns1 A T 2: 164,168,380 I153N probably damaging Het
Kmt2b A G 7: 30,577,069 L1726S probably damaging Het
Loxl3 A G 6: 83,050,133 D615G probably damaging Het
Negr1 T A 3: 157,208,399 probably benign Het
Nfasc C A 1: 132,636,993 A70S probably benign Het
Odf3l2 C T 10: 79,644,730 probably null Het
Olfr464 T A 11: 87,914,034 N291Y probably damaging Het
Olfr658 A G 7: 104,645,243 M41T probably benign Het
Olfr998 A G 2: 85,590,810 K90R probably benign Het
Otud7a T C 7: 63,697,244 probably benign Het
Pacs2 T C 12: 113,069,270 probably benign Het
Pde7b A G 10: 20,436,216 C239R probably damaging Het
Pdzd2 A T 15: 12,367,941 L2654Q probably damaging Het
Pgap1 T C 1: 54,535,951 probably null Het
Proz T A 8: 13,065,356 M124K probably benign Het
Raet1d A G 10: 22,371,429 T135A probably benign Het
Rapgef1 A G 2: 29,702,670 N558S possibly damaging Het
Rpl7 C G 1: 16,103,222 G101A possibly damaging Het
Sec14l1 G A 11: 117,147,098 probably benign Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Simc1 G T 13: 54,550,525 L1319F probably damaging Het
Sspo A G 6: 48,461,495 E1499G possibly damaging Het
Tango6 C T 8: 106,747,361 probably benign Het
Tas2r118 T C 6: 23,969,339 Y241C probably damaging Het
Tbck A G 3: 132,724,875 E344G probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Thop1 T A 10: 81,080,245 probably benign Het
Tmbim7 A T 5: 3,666,866 Y66F probably benign Het
Tmc8 C T 11: 117,786,381 probably benign Het
Tnfrsf19 A G 14: 60,973,592 S216P possibly damaging Het
Trappc2l A G 8: 122,614,393 probably benign Het
Trim67 A G 8: 124,823,190 R520G probably damaging Het
Ubp1 T A 9: 113,966,587 probably null Het
Vil1 T C 1: 74,426,694 L548P probably damaging Het
Wdr3 A G 3: 100,145,657 V593A probably damaging Het
Wdr5 A G 2: 27,533,013 Y243C probably damaging Het
Zan T C 5: 137,421,822 T2858A unknown Het
Zbtb37 A T 1: 161,020,369 V356E probably benign Het
Zfp36 C T 7: 28,378,334 V50I probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in Cadps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cadps APN 14 12491795 missense probably damaging 1.00
IGL00990:Cadps APN 14 12715374 missense possibly damaging 0.56
IGL01071:Cadps APN 14 12509091 splice site probably null
IGL01339:Cadps APN 14 12486543 missense possibly damaging 0.58
IGL01518:Cadps APN 14 12522352 missense probably damaging 1.00
IGL01560:Cadps APN 14 12491792 missense probably damaging 1.00
IGL01598:Cadps APN 14 12522202 critical splice donor site probably null
IGL01603:Cadps APN 14 12454154 splice site probably benign
IGL01836:Cadps APN 14 12522311 missense probably damaging 1.00
IGL01839:Cadps APN 14 12467184 splice site probably benign
IGL01932:Cadps APN 14 12373609 utr 3 prime probably benign
IGL02172:Cadps APN 14 12705681 missense probably damaging 1.00
IGL02175:Cadps APN 14 12467092 missense probably damaging 0.96
IGL02212:Cadps APN 14 12522345 missense possibly damaging 0.94
IGL02351:Cadps APN 14 12597380 missense probably damaging 0.99
IGL02358:Cadps APN 14 12597380 missense probably damaging 0.99
IGL02499:Cadps APN 14 12822725 nonsense probably null
IGL02505:Cadps APN 14 12449759 missense probably damaging 1.00
IGL02591:Cadps APN 14 12473465 missense probably damaging 1.00
IGL02592:Cadps APN 14 12473465 missense probably damaging 1.00
IGL02671:Cadps APN 14 12491824 missense probably damaging 1.00
IGL02956:Cadps APN 14 12418047 splice site probably benign
IGL03029:Cadps APN 14 12376675 missense probably damaging 1.00
IGL03216:Cadps APN 14 12439944 missense probably damaging 1.00
IGL03282:Cadps APN 14 12465856 splice site probably benign
turbo UTSW 14 12491800 missense probably damaging 1.00
R0241:Cadps UTSW 14 12376675 missense probably damaging 1.00
R0420:Cadps UTSW 14 12491800 missense probably damaging 1.00
R1180:Cadps UTSW 14 12457836 splice site probably benign
R1398:Cadps UTSW 14 12449822 missense probably damaging 1.00
R1678:Cadps UTSW 14 12517802 critical splice donor site probably null
R1792:Cadps UTSW 14 12449802 missense possibly damaging 0.93
R1863:Cadps UTSW 14 12449802 missense possibly damaging 0.93
R1863:Cadps UTSW 14 12505796 missense probably benign 0.09
R1918:Cadps UTSW 14 12546372 missense probably damaging 0.99
R1920:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1921:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1922:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1925:Cadps UTSW 14 12705726 missense probably damaging 1.00
R1966:Cadps UTSW 14 12822450 nonsense probably null
R2013:Cadps UTSW 14 12522337 missense probably damaging 1.00
R2228:Cadps UTSW 14 12465935 missense probably benign 0.05
R2331:Cadps UTSW 14 12603692 missense probably damaging 1.00
R3436:Cadps UTSW 14 12616158 splice site probably null
R3853:Cadps UTSW 14 12509090 splice site probably benign
R3893:Cadps UTSW 14 12488883 utr 3 prime probably benign
R3916:Cadps UTSW 14 12457702 missense probably benign 0.00
R3917:Cadps UTSW 14 12457702 missense probably benign 0.00
R3953:Cadps UTSW 14 12505937 missense probably damaging 1.00
R3966:Cadps UTSW 14 12522161 splice site probably null
R4024:Cadps UTSW 14 12705539 missense probably damaging 1.00
R4079:Cadps UTSW 14 12457702 missense probably benign 0.00
R4230:Cadps UTSW 14 12488987 missense probably damaging 0.98
R4333:Cadps UTSW 14 12467031 missense probably damaging 1.00
R4410:Cadps UTSW 14 12822323 missense probably damaging 0.98
R4586:Cadps UTSW 14 12505808 missense probably damaging 1.00
R4685:Cadps UTSW 14 12467139 missense possibly damaging 0.77
R4698:Cadps UTSW 14 12705654 missense possibly damaging 0.90
R4855:Cadps UTSW 14 12822449 missense unknown
R4898:Cadps UTSW 14 12411588 missense possibly damaging 0.86
R4908:Cadps UTSW 14 12536386 missense probably damaging 1.00
R5208:Cadps UTSW 14 12457711 missense possibly damaging 0.68
R5297:Cadps UTSW 14 12822345 missense probably damaging 1.00
R5328:Cadps UTSW 14 12457790 missense probably benign 0.31
R5408:Cadps UTSW 14 12705759 missense possibly damaging 0.87
R5529:Cadps UTSW 14 12454285 missense probably damaging 1.00
R5567:Cadps UTSW 14 12473497 missense possibly damaging 0.49
R5570:Cadps UTSW 14 12473497 missense possibly damaging 0.49
R5727:Cadps UTSW 14 12486525 nonsense probably null
R5812:Cadps UTSW 14 12376685 missense probably benign
R6361:Cadps UTSW 14 12491778 nonsense probably null
R6767:Cadps UTSW 14 12550888 missense probably damaging 1.00
R6805:Cadps UTSW 14 12467103 missense probably damaging 0.99
R6861:Cadps UTSW 14 12522401 nonsense probably null
R6883:Cadps UTSW 14 12465883 missense probably damaging 0.96
R6887:Cadps UTSW 14 12505811 missense probably damaging 1.00
R6997:Cadps UTSW 14 12505793 missense possibly damaging 0.88
R7102:Cadps UTSW 14 12603738 missense probably damaging 1.00
R7120:Cadps UTSW 14 12439919 missense probably damaging 0.98
R7143:Cadps UTSW 14 12491838 missense probably benign 0.02
R7290:Cadps UTSW 14 12616099 missense probably damaging 1.00
R7614:Cadps UTSW 14 12454260 missense probably damaging 1.00
R7674:Cadps UTSW 14 12411581 missense probably damaging 0.99
R7715:Cadps UTSW 14 12457762 missense probably benign 0.01
R7801:Cadps UTSW 14 12489476 critical splice donor site probably null
R7814:Cadps UTSW 14 12376706 missense probably damaging 0.99
R7915:Cadps UTSW 14 12705544 missense possibly damaging 0.84
R8087:Cadps UTSW 14 12536380 missense probably damaging 1.00
R8109:Cadps UTSW 14 12488975 missense probably benign 0.00
X0018:Cadps UTSW 14 12373690 missense probably damaging 1.00
X0028:Cadps UTSW 14 12467118 missense possibly damaging 0.93
Z1088:Cadps UTSW 14 12467113 missense probably damaging 0.96
Z1177:Cadps UTSW 14 12465880 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCCAAAGCAAGCTTTCAAAAGTG -3'
(R):5'- GAAACAGTCTTCAGACATGGACCCC -3'

Sequencing Primer
(F):5'- GCTGCCTTAGAAATCATCGTG -3'
(R):5'- TGTGTGTAGCACAAGAGTCCC -3'
Posted On2013-07-11