Incidental Mutation 'R7719:Myo5a'
ID 595124
Institutional Source Beutler Lab
Gene Symbol Myo5a
Ensembl Gene ENSMUSG00000034593
Gene Name myosin VA
Synonyms 9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock # R7719 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 75071015-75223688 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75144084 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 320 (S320T)
Ref Sequence ENSEMBL: ENSMUSP00000117493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]
AlphaFold Q99104
Predicted Effect probably benign
Transcript: ENSMUST00000123128
AA Change: S320T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: S320T

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123531
Predicted Effect probably benign
Transcript: ENSMUST00000136731
AA Change: S320T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: S320T

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155282
AA Change: S320T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: S320T

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,327,355 I633T probably benign Het
Acbd6 T A 1: 155,687,012 L253H probably damaging Het
Adam11 T C 11: 102,772,477 V238A probably benign Het
Amer3 A T 1: 34,589,002 H774L possibly damaging Het
Anapc15 T C 7: 101,901,029 L150P unknown Het
Ano8 G T 8: 71,483,140 T278K possibly damaging Het
Atg16l2 T C 7: 101,289,867 K618E probably damaging Het
Casz1 C T 4: 148,944,524 S1142L probably damaging Het
Ccdc30 T A 4: 119,333,616 E471D probably damaging Het
Cks1b T C 3: 89,416,328 N45D probably benign Het
Clasrp T C 7: 19,587,844 T296A probably damaging Het
Cluap1 C T 16: 3,909,603 probably null Het
Cntn5 T A 9: 9,704,898 D632V probably damaging Het
Cntnap3 G A 13: 64,772,777 Q593* probably null Het
Col18a1 A T 10: 77,078,012 I457K probably benign Het
Crybb3 G T 5: 113,075,968 Q192K probably damaging Het
Cyb561d2 C T 9: 107,540,184 A123T probably benign Het
Cyp2b13 C T 7: 26,095,670 A442V probably damaging Het
Cyp2j9 G A 4: 96,568,842 T464I probably benign Het
Cyp4a29 G A 4: 115,250,940 G320R possibly damaging Het
Dbp T C 7: 45,709,750 I283T probably damaging Het
Efcab3 T C 11: 105,111,848 I303T probably benign Het
Efcab8 T A 2: 153,787,745 V166D Het
Efhc1 A T 1: 20,979,520 I535F probably benign Het
Epb41l3 A G 17: 69,253,414 I319V possibly damaging Het
Ewsr1 T C 11: 5,085,900 T193A unknown Het
Fam227a T C 15: 79,620,712 N510S possibly damaging Het
Frmpd1 T C 4: 45,284,841 C1221R possibly damaging Het
Gm6741 A C 17: 91,237,044 E78D probably benign Het
Gpam C T 19: 55,081,670 V385I probably damaging Het
Gpr55 A G 1: 85,941,337 V174A probably benign Het
Gsdmc T C 15: 63,778,964 probably null Het
Hmcn1 T A 1: 150,565,329 D5509V possibly damaging Het
Hoxc13 A T 15: 102,921,858 Q224L possibly damaging Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Igsf3 G A 3: 101,435,541 R478H probably damaging Het
Itgb5 A G 16: 33,920,116 Q532R probably benign Het
Jph1 T C 1: 17,091,991 Y149C probably damaging Het
Lztfl1 T C 9: 123,715,330 D33G probably null Het
Mex3c G T 18: 73,589,990 A385S possibly damaging Het
Nsun4 A T 4: 116,052,420 N314K possibly damaging Het
Olfr1271 A T 2: 90,266,259 M57K probably damaging Het
Omg T A 11: 79,502,233 E266D probably benign Het
Paqr9 T A 9: 95,560,776 V273E possibly damaging Het
Phkg1 G A 5: 129,873,858 probably benign Het
Plekhm3 T C 1: 64,921,742 K452E probably benign Het
Plpbp T A 8: 27,045,946 I86N Het
Prl2c1 G T 13: 27,851,797 A51S probably damaging Het
Prmt8 A T 6: 127,729,503 H108Q probably damaging Het
Prrc2b T A 2: 32,217,268 C1614* probably null Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Rassf9 A G 10: 102,545,600 D281G probably benign Het
Rmnd1 T C 10: 4,427,496 D61G probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Ryr2 A G 13: 11,730,343 S2055P possibly damaging Het
Six5 G A 7: 19,096,878 A477T probably damaging Het
Speg A G 1: 75,375,825 E129G probably damaging Het
Stard10 C T 7: 101,346,113 A78V not run Het
Stard3 T C 11: 98,375,676 V127A probably benign Het
Svep1 G A 4: 58,068,523 P3088S probably damaging Het
Tbck A G 3: 132,734,728 D508G probably damaging Het
Tgm2 T A 2: 158,143,118 T23S probably damaging Het
Ttll10 G T 4: 156,047,208 probably null Het
Vcan A T 13: 89,704,619 S741T probably damaging Het
Vmn2r13 T C 5: 109,171,752 N454S probably benign Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Wnt8a T C 18: 34,547,535 W318R probably damaging Het
Zer1 A T 2: 30,111,231 L87H probably damaging Het
Zfp518a T A 19: 40,912,768 N380K probably benign Het
Zfp90 T C 8: 106,419,093 V19A probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Myo5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75161497 nonsense probably null
IGL00547:Myo5a APN 9 75141453 missense probably benign 0.00
IGL00788:Myo5a APN 9 75168959 missense probably benign 0.15
IGL01327:Myo5a APN 9 75187538 splice site probably benign
IGL01687:Myo5a APN 9 75156249 missense probably benign 0.12
IGL01886:Myo5a APN 9 75169090 splice site probably benign
IGL01945:Myo5a APN 9 75140671 missense probably damaging 1.00
IGL02127:Myo5a APN 9 75212981 missense probably benign 0.12
IGL02137:Myo5a APN 9 75161535 splice site probably null
IGL02183:Myo5a APN 9 75167236 splice site probably benign
IGL02427:Myo5a APN 9 75176618 splice site probably benign
IGL02490:Myo5a APN 9 75136455 missense probably damaging 1.00
IGL02574:Myo5a APN 9 75211147 missense probably benign 0.00
IGL02886:Myo5a APN 9 75151887 splice site probably benign
IGL02961:Myo5a APN 9 75215120 missense probably benign 0.04
IGL03090:Myo5a APN 9 75120833 missense probably damaging 1.00
IGL03119:Myo5a APN 9 75174015 missense probably benign 0.01
IGL03237:Myo5a APN 9 75129994 missense probably damaging 1.00
IGL03296:Myo5a APN 9 75116202 missense probably damaging 1.00
naoki UTSW 9 75161492 missense probably damaging 1.00
new_gray UTSW 9 missense
nut UTSW 9 splice donor site
silver_decerebrate UTSW 9 75164195 missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75211127 missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75130141 splice site probably benign
IGL03050:Myo5a UTSW 9 75146909 splice site probably null
PIT4403001:Myo5a UTSW 9 75217523 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0091:Myo5a UTSW 9 75161492 missense probably damaging 1.00
R0142:Myo5a UTSW 9 75160574 missense probably benign 0.01
R0243:Myo5a UTSW 9 75186123 critical splice donor site probably null
R0395:Myo5a UTSW 9 75193977 missense probably benign 0.39
R0427:Myo5a UTSW 9 75174196 missense probably benign 0.00
R0545:Myo5a UTSW 9 75167037 missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75180112 missense probably benign 0.00
R0601:Myo5a UTSW 9 75174015 missense probably benign 0.01
R1457:Myo5a UTSW 9 75213065 missense probably damaging 0.99
R1510:Myo5a UTSW 9 75171551 missense probably benign
R1548:Myo5a UTSW 9 75171746 missense probably damaging 1.00
R1759:Myo5a UTSW 9 75181993 missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75116207 missense probably damaging 1.00
R1960:Myo5a UTSW 9 75147857 missense probably damaging 1.00
R2050:Myo5a UTSW 9 75146874 missense probably benign 0.01
R2070:Myo5a UTSW 9 75181984 missense probably benign 0.03
R2075:Myo5a UTSW 9 75189918 missense probably benign 0.01
R2148:Myo5a UTSW 9 75180147 missense probably damaging 1.00
R2201:Myo5a UTSW 9 75217943 missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75203801 missense probably damaging 1.00
R2357:Myo5a UTSW 9 75201365 missense probably damaging 0.99
R2392:Myo5a UTSW 9 75209239 missense probably benign 0.02
R2432:Myo5a UTSW 9 75212873 missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75123040 missense probably damaging 1.00
R2568:Myo5a UTSW 9 75151897 missense probably damaging 1.00
R2932:Myo5a UTSW 9 75196136 missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75116202 missense probably damaging 1.00
R4231:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75144171 missense probably benign
R4321:Myo5a UTSW 9 75217530 missense probably damaging 0.99
R4450:Myo5a UTSW 9 75167176 missense probably benign 0.00
R4573:Myo5a UTSW 9 75201297 splice site probably null
R4577:Myo5a UTSW 9 75217545 missense probably damaging 1.00
R4601:Myo5a UTSW 9 75136388 missense probably damaging 1.00
R4690:Myo5a UTSW 9 75153823 missense probably damaging 0.99
R4691:Myo5a UTSW 9 75180156 missense probably damaging 0.99
R4764:Myo5a UTSW 9 75116336 intron probably benign
R4767:Myo5a UTSW 9 75144076 missense probably damaging 0.99
R4811:Myo5a UTSW 9 75141543 critical splice donor site probably null
R4829:Myo5a UTSW 9 75136407 missense probably damaging 1.00
R4863:Myo5a UTSW 9 75217507 missense probably damaging 1.00
R4902:Myo5a UTSW 9 75174078 missense probably benign
R4947:Myo5a UTSW 9 75123048 missense probably damaging 1.00
R5074:Myo5a UTSW 9 75174156 missense probably benign
R5095:Myo5a UTSW 9 75152020 missense probably damaging 1.00
R5095:Myo5a UTSW 9 75184389 nonsense probably null
R5254:Myo5a UTSW 9 75130120 missense probably damaging 1.00
R5267:Myo5a UTSW 9 75152010 missense probably damaging 1.00
R5419:Myo5a UTSW 9 75147897 missense probably damaging 1.00
R5514:Myo5a UTSW 9 75153766 missense probably damaging 1.00
R5629:Myo5a UTSW 9 75203845 missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75171719 missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75167206 missense probably benign 0.02
R5665:Myo5a UTSW 9 75144181 critical splice donor site probably null
R5719:Myo5a UTSW 9 75151931 missense probably damaging 1.00
R5964:Myo5a UTSW 9 75203833 missense probably benign 0.09
R6014:Myo5a UTSW 9 75167207 nonsense probably null
R6344:Myo5a UTSW 9 75160509 missense probably benign 0.09
R6345:Myo5a UTSW 9 75189913 missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75146967 missense probably damaging 0.98
R6712:Myo5a UTSW 9 75212900 missense probably benign 0.12
R6838:Myo5a UTSW 9 75153883 critical splice donor site probably null
R6866:Myo5a UTSW 9 75140688 missense probably damaging 1.00
R6876:Myo5a UTSW 9 75160490 missense probably benign 0.04
R7108:Myo5a UTSW 9 75129992 missense probably damaging 1.00
R7159:Myo5a UTSW 9 75171563 missense probably benign 0.07
R7164:Myo5a UTSW 9 75180153 missense probably benign 0.00
R7219:Myo5a UTSW 9 75120770 missense probably damaging 1.00
R7497:Myo5a UTSW 9 75197701 missense
R7620:Myo5a UTSW 9 75164136 missense probably benign 0.41
R7810:Myo5a UTSW 9 75160465 missense probably benign 0.09
R7810:Myo5a UTSW 9 75169010 missense probably benign
R7866:Myo5a UTSW 9 75203752 missense probably damaging 1.00
R7939:Myo5a UTSW 9 75189900 missense
R8050:Myo5a UTSW 9 75181946 missense probably damaging 0.99
R8061:Myo5a UTSW 9 75122957 nonsense probably null
R8326:Myo5a UTSW 9 75217989 missense probably damaging 0.98
R8529:Myo5a UTSW 9 75212872 missense probably benign 0.02
R8824:Myo5a UTSW 9 75167046 missense probably damaging 1.00
R8858:Myo5a UTSW 9 75184683 missense probably damaging 0.99
R9040:Myo5a UTSW 9 75174059 missense probably benign 0.07
R9092:Myo5a UTSW 9 75147132 critical splice donor site probably null
R9249:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R9274:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R9293:Myo5a UTSW 9 75180030 missense probably benign 0.37
R9366:Myo5a UTSW 9 75217518 missense probably damaging 0.98
R9410:Myo5a UTSW 9 75116214 missense probably damaging 0.98
X0010:Myo5a UTSW 9 75185905 missense probably damaging 1.00
Z1177:Myo5a UTSW 9 75186036 missense
Predicted Primers PCR Primer
(F):5'- CCCACATTGCTAAACTGCCTAG -3'
(R):5'- CAGAGACCCCTAGCTTGTTCTAC -3'

Sequencing Primer
(F):5'- GCTAAACTGCCTAGTATGTTACTGTC -3'
(R):5'- CTTGTTCTAGCCCCAGTAGTAAAAG -3'
Posted On 2019-11-12