Mutagenetix > Incidental Mutation

Incidental Mutation 'R7719:Cntnap3'

595139

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R7719 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 64772777 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 593 (Q593*)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably null
Transcript: ENSMUST00000091554
AA Change: Q593*

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: Q593*

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	C	6: 149,327,355	I633T	probably benign	Het
Acbd6	T	A	1: 155,687,012	L253H	probably damaging	Het
Adam11	T	C	11: 102,772,477	V238A	probably benign	Het
Amer3	A	T	1: 34,589,002	H774L	possibly damaging	Het
Anapc15	T	C	7: 101,901,029	L150P	unknown	Het
Ano8	G	T	8: 71,483,140	T278K	possibly damaging	Het
Atg16l2	T	C	7: 101,289,867	K618E	probably damaging	Het
Casz1	C	T	4: 148,944,524	S1142L	probably damaging	Het
Ccdc30	T	A	4: 119,333,616	E471D	probably damaging	Het
Cks1b	T	C	3: 89,416,328	N45D	probably benign	Het
Clasrp	T	C	7: 19,587,844	T296A	probably damaging	Het
Cluap1	C	T	16: 3,909,603		probably null	Het
Cntn5	T	A	9: 9,704,898	D632V	probably damaging	Het
Col18a1	A	T	10: 77,078,012	I457K	probably benign	Het
Crybb3	G	T	5: 113,075,968	Q192K	probably damaging	Het
Cyb561d2	C	T	9: 107,540,184	A123T	probably benign	Het
Cyp2b13	C	T	7: 26,095,670	A442V	probably damaging	Het
Cyp2j9	G	A	4: 96,568,842	T464I	probably benign	Het
Cyp4a29	G	A	4: 115,250,940	G320R	possibly damaging	Het
Dbp	T	C	7: 45,709,750	I283T	probably damaging	Het
Efcab3	T	C	11: 105,111,848	I303T	probably benign	Het
Efcab8	T	A	2: 153,787,745	V166D		Het
Efhc1	A	T	1: 20,979,520	I535F	probably benign	Het
Epb41l3	A	G	17: 69,253,414	I319V	possibly damaging	Het
Ewsr1	T	C	11: 5,085,900	T193A	unknown	Het
Fam227a	T	C	15: 79,620,712	N510S	possibly damaging	Het
Frmpd1	T	C	4: 45,284,841	C1221R	possibly damaging	Het
Gm6741	A	C	17: 91,237,044	E78D	probably benign	Het
Gpam	C	T	19: 55,081,670	V385I	probably damaging	Het
Gpr55	A	G	1: 85,941,337	V174A	probably benign	Het
Gsdmc	T	C	15: 63,778,964		probably null	Het
Hmcn1	T	A	1: 150,565,329	D5509V	possibly damaging	Het
Hoxc13	A	T	15: 102,921,858	Q224L	possibly damaging	Het
Hunk	A	G	16: 90,496,666	D612G	probably benign	Het
Igsf3	G	A	3: 101,435,541	R478H	probably damaging	Het
Itgb5	A	G	16: 33,920,116	Q532R	probably benign	Het
Jph1	T	C	1: 17,091,991	Y149C	probably damaging	Het
Lztfl1	T	C	9: 123,715,330	D33G	probably null	Het
Mex3c	G	T	18: 73,589,990	A385S	possibly damaging	Het
Myo5a	T	A	9: 75,144,084	S320T	probably benign	Het
Nsun4	A	T	4: 116,052,420	N314K	possibly damaging	Het
Olfr1271	A	T	2: 90,266,259	M57K	probably damaging	Het
Omg	T	A	11: 79,502,233	E266D	probably benign	Het
Paqr9	T	A	9: 95,560,776	V273E	possibly damaging	Het
Phkg1	G	A	5: 129,873,858		probably benign	Het
Plekhm3	T	C	1: 64,921,742	K452E	probably benign	Het
Plpbp	T	A	8: 27,045,946	I86N		Het
Prl2c1	G	T	13: 27,851,797	A51S	probably damaging	Het
Prmt8	A	T	6: 127,729,503	H108Q	probably damaging	Het
Prrc2b	T	A	2: 32,217,268	C1614*	probably null	Het
Ptpdc1	A	G	13: 48,586,290	V555A	probably benign	Het
Rassf9	A	G	10: 102,545,600	D281G	probably benign	Het
Rmnd1	T	C	10: 4,427,496	D61G	probably benign	Het
Rsf1	GGCG	GGCGACGGCCGCG	7: 97,579,906		probably benign	Het
Ryr2	A	G	13: 11,730,343	S2055P	possibly damaging	Het
Six5	G	A	7: 19,096,878	A477T	probably damaging	Het
Speg	A	G	1: 75,375,825	E129G	probably damaging	Het
Stard10	C	T	7: 101,346,113	A78V	not run	Het
Stard3	T	C	11: 98,375,676	V127A	probably benign	Het
Svep1	G	A	4: 58,068,523	P3088S	probably damaging	Het
Tbck	A	G	3: 132,734,728	D508G	probably damaging	Het
Tgm2	T	A	2: 158,143,118	T23S	probably damaging	Het
Ttll10	G	T	4: 156,047,208		probably null	Het
Vcan	A	T	13: 89,704,619	S741T	probably damaging	Het
Vmn2r13	T	C	5: 109,171,752	N454S	probably benign	Het
Vmn2r45	T	A	7: 8,483,461	E276V	probably damaging	Het
Wnt8a	T	C	18: 34,547,535	W318R	probably damaging	Het
Zer1	A	T	2: 30,111,231	L87H	probably damaging	Het
Zfp518a	T	A	19: 40,912,768	N380K	probably benign	Het
Zfp90	T	C	8: 106,419,093	V19A	probably damaging	Het
Zkscan5	A	C	5: 145,220,866	H726P	probably damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGGATGATGCAGTATTTCTACTTCG -3'
(R):5'- TATAGGAATGCTCAGCCACACC -3'

Sequencing Primer
(F):5'- CCTGTCATATTGCAGTATACAAG -3'
(R):5'- ATTCCTAACTAGGTGCTGGGAAC -3'

Posted On

2019-11-12