Incidental Mutation 'R7719:Cntnap3'
ID595139
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Namecontactin associated protein-like 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7719 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location64736182-64903955 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 64772777 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 593 (Q593*)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
Predicted Effect probably null
Transcript: ENSMUST00000091554
AA Change: Q593*
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: Q593*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,327,355 I633T probably benign Het
Acbd6 T A 1: 155,687,012 L253H probably damaging Het
Adam11 T C 11: 102,772,477 V238A probably benign Het
Amer3 A T 1: 34,589,002 H774L possibly damaging Het
Anapc15 T C 7: 101,901,029 L150P unknown Het
Ano8 G T 8: 71,483,140 T278K possibly damaging Het
Atg16l2 T C 7: 101,289,867 K618E probably damaging Het
Casz1 C T 4: 148,944,524 S1142L probably damaging Het
Ccdc30 T A 4: 119,333,616 E471D probably damaging Het
Cks1b T C 3: 89,416,328 N45D probably benign Het
Clasrp T C 7: 19,587,844 T296A probably damaging Het
Cluap1 C T 16: 3,909,603 probably null Het
Cntn5 T A 9: 9,704,898 D632V probably damaging Het
Col18a1 A T 10: 77,078,012 I457K probably benign Het
Crybb3 G T 5: 113,075,968 Q192K probably damaging Het
Cyb561d2 C T 9: 107,540,184 A123T probably benign Het
Cyp2b13 C T 7: 26,095,670 A442V probably damaging Het
Cyp2j9 G A 4: 96,568,842 T464I probably benign Het
Cyp4a29 G A 4: 115,250,940 G320R possibly damaging Het
Dbp T C 7: 45,709,750 I283T probably damaging Het
Efcab3 T C 11: 105,111,848 I303T probably benign Het
Efcab8 T A 2: 153,787,745 V166D Het
Efhc1 A T 1: 20,979,520 I535F probably benign Het
Epb41l3 A G 17: 69,253,414 I319V possibly damaging Het
Ewsr1 T C 11: 5,085,900 T193A unknown Het
Fam227a T C 15: 79,620,712 N510S possibly damaging Het
Frmpd1 T C 4: 45,284,841 C1221R possibly damaging Het
Gm6741 A C 17: 91,237,044 E78D probably benign Het
Gpam C T 19: 55,081,670 V385I probably damaging Het
Gpr55 A G 1: 85,941,337 V174A probably benign Het
Gsdmc T C 15: 63,778,964 probably null Het
Hmcn1 T A 1: 150,565,329 D5509V possibly damaging Het
Hoxc13 A T 15: 102,921,858 Q224L possibly damaging Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Igsf3 G A 3: 101,435,541 R478H probably damaging Het
Itgb5 A G 16: 33,920,116 Q532R probably benign Het
Jph1 T C 1: 17,091,991 Y149C probably damaging Het
Lztfl1 T C 9: 123,715,330 D33G probably null Het
Mex3c G T 18: 73,589,990 A385S possibly damaging Het
Myo5a T A 9: 75,144,084 S320T probably benign Het
Nsun4 A T 4: 116,052,420 N314K possibly damaging Het
Olfr1271 A T 2: 90,266,259 M57K probably damaging Het
Omg T A 11: 79,502,233 E266D probably benign Het
Paqr9 T A 9: 95,560,776 V273E possibly damaging Het
Phkg1 G A 5: 129,873,858 probably benign Het
Plekhm3 T C 1: 64,921,742 K452E probably benign Het
Plpbp T A 8: 27,045,946 I86N Het
Prl2c1 G T 13: 27,851,797 A51S probably damaging Het
Prmt8 A T 6: 127,729,503 H108Q probably damaging Het
Prrc2b T A 2: 32,217,268 C1614* probably null Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Rassf9 A G 10: 102,545,600 D281G probably benign Het
Rmnd1 T C 10: 4,427,496 D61G probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Ryr2 A G 13: 11,730,343 S2055P possibly damaging Het
Six5 G A 7: 19,096,878 A477T probably damaging Het
Speg A G 1: 75,375,825 E129G probably damaging Het
Stard10 C T 7: 101,346,113 A78V not run Het
Stard3 T C 11: 98,375,676 V127A probably benign Het
Svep1 G A 4: 58,068,523 P3088S probably damaging Het
Tbck A G 3: 132,734,728 D508G probably damaging Het
Tgm2 T A 2: 158,143,118 T23S probably damaging Het
Ttll10 G T 4: 156,047,208 probably null Het
Vcan A T 13: 89,704,619 S741T probably damaging Het
Vmn2r13 T C 5: 109,171,752 N454S probably benign Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Wnt8a T C 18: 34,547,535 W318R probably damaging Het
Zer1 A T 2: 30,111,231 L87H probably damaging Het
Zfp518a T A 19: 40,912,768 N380K probably benign Het
Zfp90 T C 8: 106,419,093 V19A probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64772731 missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64745805 splice site probably benign
IGL00976:Cntnap3 APN 13 64794352 missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64787837 missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64757301 missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64799108 missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64799064 splice site probably benign
IGL02133:Cntnap3 APN 13 64751673 splice site probably benign
IGL02251:Cntnap3 APN 13 64762036 missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64757411 missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64751751 missense probably benign
IGL02456:Cntnap3 APN 13 64799058 splice site probably benign
IGL02589:Cntnap3 APN 13 64792430 missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64772132 missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64757409 missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64741025 missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64781745 missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 64887768 nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64757210 missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64757436 splice site probably benign
R0422:Cntnap3 UTSW 13 64757285 missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64778876 missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64762045 missense probably benign 0.01
R0499:Cntnap3 UTSW 13 64858678 missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64762000 missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64758414 missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64757397 missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64787910 missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64758290 missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64762002 missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64740812 critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64740592 missense probably benign 0.17
R1905:Cntnap3 UTSW 13 64903764 missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64758390 missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64794262 missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64740999 missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64748460 missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64778853 missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64778883 missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64778788 critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64778862 missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64787706 missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64761984 missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64794348 missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64762010 missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64761978 missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 64903758 missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64746738 missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64787955 missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64748577 missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64799180 missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64787769 missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64781888 missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64748559 missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64781725 critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64771962 missense probably benign
R7425:Cntnap3 UTSW 13 64758252 missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64772001 missense probably benign 0.22
R7810:Cntnap3 UTSW 13 64793308 missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 64903773 missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64787867 missense probably damaging 0.99
Z1176:Cntnap3 UTSW 13 64740872 frame shift probably null
Z1176:Cntnap3 UTSW 13 64792388 missense probably damaging 0.98
Z1177:Cntnap3 UTSW 13 64781892 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGATGATGCAGTATTTCTACTTCG -3'
(R):5'- TATAGGAATGCTCAGCCACACC -3'

Sequencing Primer
(F):5'- CCTGTCATATTGCAGTATACAAG -3'
(R):5'- ATTCCTAACTAGGTGCTGGGAAC -3'
Posted On2019-11-12