Incidental Mutation 'R7720:Prex2'
ID595151
Institutional Source Beutler Lab
Gene Symbol Prex2
Ensembl Gene ENSMUSG00000048960
Gene Namephosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
SynonymsC030045D06Rik, 6230420N16Rik, Depdc2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R7720 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location10993465-11303681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11181937 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1069 (K1069E)
Ref Sequence ENSEMBL: ENSMUSP00000027056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027056]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027056
AA Change: K1069E

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027056
Gene: ENSMUSG00000048960
AA Change: K1069E

DomainStartEndE-ValueType
RhoGEF 19 205 8.61e-45 SMART
PH 238 355 2.43e-12 SMART
DEP 383 456 4.46e-26 SMART
DEP 484 557 6.57e-15 SMART
PDZ 593 666 9.62e-2 SMART
PDZ 677 744 6.37e-8 SMART
low complexity region 1112 1127 N/A INTRINSIC
low complexity region 1498 1507 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatidylinositol 3,4,5-trisphosphate (PIP3)-dependent Rac exchanger (PREX) family, which are Dbl-type guanine-nucleotide exchange factors for Rac family small G proteins. Structural domains of this protein include the catalytic diffuse B-cell lymphoma homology and pleckstrin homology (DHPH) domain, two disheveled, EGL-10, and pleckstrin homology (DEP) domains, two PDZ domains, and a C-terminal inositol polyphosphate-4 phosphatase (IP4P) domain that is found in one of the isoforms. This protein facilitates the exchange of GDP for GTP on Rac1, allowing the GTP-bound Rac1 to activate downstream effectors. Studies also show that the pleckstrin homology domain of this protein interacts with the phosphatase and tensin homolog (PTEN) gene product to inhibit PTEN phosphatase activity, thus activating the phosphoinositide-3 kinase (PI3K) signaling pathway. Conversely, the PTEN gene product has also been shown to inhibit the GEF activity of this protein. This gene plays a role in insulin-signaling pathways, and either mutations or overexpression of this gene have been observed in some cancers. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for gene trapped alleles may exhibit abnormal Purkinje cell dendrite morphology, a mild motor coordination defect that progressively worsens with age, hypoactivity, impaired glucose tolerance and/or insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,102 C148S probably damaging Het
4921530L21Rik A G 14: 95,882,112 R102G probably benign Het
A230050P20Rik C T 9: 20,868,859 probably benign Het
Agap2 A G 10: 127,091,088 D1018G probably damaging Het
Atm T C 9: 53,522,239 N237S possibly damaging Het
Card6 G T 15: 5,098,423 Q1164K unknown Het
Cped1 G A 6: 22,222,431 C730Y probably damaging Het
Csmd1 A T 8: 15,931,108 L2770Q probably damaging Het
Ctsw T C 19: 5,467,044 T87A probably damaging Het
Dock4 T C 12: 40,806,975 I1269T probably damaging Het
F11 T C 8: 45,252,090 E138G possibly damaging Het
Fam124b A G 1: 80,200,257 S342P probably damaging Het
Fam71d T C 12: 78,712,133 S76P probably damaging Het
Gipr T C 7: 19,162,959 I129V probably benign Het
Gm5415 T C 1: 32,546,097 D244G probably benign Het
Gria4 A T 9: 4,464,288 V558D probably damaging Het
Gsdme C T 6: 50,229,308 G185E probably damaging Het
Hgd T A 16: 37,593,435 D86E probably benign Het
Hmcn1 T A 1: 150,646,709 H3480L probably benign Het
Hs2st1 T C 3: 144,454,022 N127D probably damaging Het
Ilf3 A G 9: 21,399,537 N599S possibly damaging Het
Itsn1 G A 16: 91,868,083 G1132R unknown Het
Jakmip2 A G 18: 43,571,908 S343P possibly damaging Het
Kif1b A G 4: 149,182,355 V1670A probably benign Het
Lman2 A T 13: 55,353,077 probably null Het
Ltbp1 A T 17: 75,385,124 Y1579F probably damaging Het
Mon2 G A 10: 123,032,588 A520V probably benign Het
Mrpl10 T G 11: 97,047,537 V171G possibly damaging Het
Mrps27 A T 13: 99,401,330 T153S unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nlrp10 A G 7: 108,924,488 V595A probably benign Het
Nol4 A T 18: 23,040,023 M7K probably benign Het
Oasl1 G A 5: 114,929,921 S188N probably damaging Het
Olfr193 T C 16: 59,109,771 I280V probably benign Het
Olfr709-ps1 C A 7: 106,927,411 G16V probably benign Het
Pcdhga2 A G 18: 37,669,940 Y279C probably damaging Het
Pfpl C T 19: 12,429,174 A263V probably benign Het
Phf3 T G 1: 30,829,857 K703N probably damaging Het
Pik3ca C G 3: 32,436,218 P5A probably damaging Het
Plekha6 T C 1: 133,293,707 V987A probably damaging Het
Ppp3ca T A 3: 136,890,489 I305N probably damaging Het
Prss50 T C 9: 110,861,335 V182A probably damaging Het
Ptprg A G 14: 12,211,703 N995S probably benign Het
Robo2 C A 16: 73,897,015 G1375V probably benign Het
Rtl1 T C 12: 109,594,430 Y325C possibly damaging Het
Shcbp1 A C 8: 4,748,720 S400A probably damaging Het
Sirpb1c T A 3: 15,832,072 Y380F probably benign Het
Tbl2 G C 5: 135,159,475 L374F probably damaging Het
Tpr C A 1: 150,429,532 A1524E possibly damaging Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Vps16 C T 2: 130,441,703 Q606* probably null Het
Vstm5 A T 9: 15,239,356 Q29L probably benign Het
Wipi1 G T 11: 109,582,423 S250Y probably damaging Het
Other mutations in Prex2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Prex2 APN 1 11186652 missense possibly damaging 0.51
IGL00948:Prex2 APN 1 11170614 missense probably damaging 0.98
IGL01087:Prex2 APN 1 11068104 missense probably benign 0.00
IGL01490:Prex2 APN 1 11184545 splice site probably null
IGL01533:Prex2 APN 1 11186741 nonsense probably null
IGL01661:Prex2 APN 1 11208614 missense probably benign 0.01
IGL01668:Prex2 APN 1 11153645 missense probably benign 0.00
IGL01674:Prex2 APN 1 11170741 missense probably damaging 1.00
IGL01716:Prex2 APN 1 11266054 missense probably benign 0.04
IGL01867:Prex2 APN 1 11098503 missense probably benign 0.11
IGL01954:Prex2 APN 1 11140011 missense possibly damaging 0.75
IGL01990:Prex2 APN 1 11123233 splice site probably benign
IGL02022:Prex2 APN 1 11297739 missense probably benign 0.04
IGL02130:Prex2 APN 1 11112799 missense probably damaging 1.00
IGL02130:Prex2 APN 1 11160162 missense probably damaging 1.00
IGL02221:Prex2 APN 1 11061345 missense probably benign 0.00
IGL02369:Prex2 APN 1 11101169 critical splice donor site probably null
IGL02440:Prex2 APN 1 11153657 missense possibly damaging 0.94
IGL02477:Prex2 APN 1 11204154 missense probably benign
IGL02492:Prex2 APN 1 11123845 missense possibly damaging 0.93
IGL03051:Prex2 APN 1 11142665 missense probably damaging 1.00
IGL03154:Prex2 APN 1 11153633 missense possibly damaging 0.63
IGL03158:Prex2 APN 1 11266067 missense possibly damaging 0.89
IGL03308:Prex2 APN 1 11185175 missense possibly damaging 0.89
IGL03338:Prex2 APN 1 11140265 missense probably benign 0.01
R0042:Prex2 UTSW 1 11080081 missense probably damaging 1.00
R0052:Prex2 UTSW 1 11160156 missense probably damaging 1.00
R0052:Prex2 UTSW 1 11160156 missense probably damaging 1.00
R0138:Prex2 UTSW 1 11285043 splice site probably benign
R0206:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0206:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0208:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0325:Prex2 UTSW 1 11200057 splice site probably null
R0326:Prex2 UTSW 1 11285065 missense probably damaging 1.00
R0390:Prex2 UTSW 1 11089706 splice site probably null
R0492:Prex2 UTSW 1 11186633 splice site probably benign
R0512:Prex2 UTSW 1 11199933 missense probably benign
R0515:Prex2 UTSW 1 11199874 missense probably damaging 0.99
R0894:Prex2 UTSW 1 11181898 missense probably benign
R1259:Prex2 UTSW 1 11289270 missense probably damaging 1.00
R1332:Prex2 UTSW 1 11204091 missense probably damaging 1.00
R1356:Prex2 UTSW 1 11080092 nonsense probably null
R1451:Prex2 UTSW 1 11156259 missense probably benign 0.01
R1488:Prex2 UTSW 1 11193528 missense probably benign 0.05
R1512:Prex2 UTSW 1 11061330 missense possibly damaging 0.64
R1641:Prex2 UTSW 1 11231772 missense probably damaging 0.99
R1667:Prex2 UTSW 1 11186757 missense probably benign
R1678:Prex2 UTSW 1 11285089 missense possibly damaging 0.51
R1736:Prex2 UTSW 1 11089884 splice site probably benign
R1781:Prex2 UTSW 1 11199955 missense probably benign 0.17
R1804:Prex2 UTSW 1 11132342 missense probably damaging 1.00
R1836:Prex2 UTSW 1 11136780 missense probably damaging 1.00
R1899:Prex2 UTSW 1 11162366 nonsense probably null
R1900:Prex2 UTSW 1 11162366 nonsense probably null
R2020:Prex2 UTSW 1 11162312 missense probably damaging 0.98
R2114:Prex2 UTSW 1 11186713 missense probably damaging 1.00
R2117:Prex2 UTSW 1 11186713 missense probably damaging 1.00
R2436:Prex2 UTSW 1 11266152 missense possibly damaging 0.90
R2902:Prex2 UTSW 1 11208614 missense possibly damaging 0.77
R2915:Prex2 UTSW 1 11169853 missense probably damaging 1.00
R2924:Prex2 UTSW 1 11098487 missense probably damaging 1.00
R2981:Prex2 UTSW 1 11181962 missense probably damaging 1.00
R3430:Prex2 UTSW 1 11149854 missense possibly damaging 0.88
R3832:Prex2 UTSW 1 11156364 splice site probably benign
R3870:Prex2 UTSW 1 11160192 missense possibly damaging 0.86
R3963:Prex2 UTSW 1 11110357 missense possibly damaging 0.93
R4012:Prex2 UTSW 1 11184516 missense probably benign
R4030:Prex2 UTSW 1 11208568 missense probably benign 0.06
R4214:Prex2 UTSW 1 11101159 missense probably damaging 1.00
R4214:Prex2 UTSW 1 11285061 missense probably damaging 1.00
R4242:Prex2 UTSW 1 11156304 missense probably benign 0.06
R4490:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4491:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4492:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4561:Prex2 UTSW 1 11184545 splice site probably null
R4624:Prex2 UTSW 1 11289265 nonsense probably null
R4647:Prex2 UTSW 1 11162285 missense probably damaging 1.00
R4657:Prex2 UTSW 1 11065825 missense probably benign 0.00
R4706:Prex2 UTSW 1 11199988 missense probably damaging 1.00
R4806:Prex2 UTSW 1 11068020 missense probably damaging 1.00
R4900:Prex2 UTSW 1 11149905 splice site probably benign
R4922:Prex2 UTSW 1 11169940 missense probably damaging 1.00
R4961:Prex2 UTSW 1 11098481 missense possibly damaging 0.75
R5284:Prex2 UTSW 1 11266090 nonsense probably null
R5305:Prex2 UTSW 1 11107678 missense probably damaging 1.00
R5307:Prex2 UTSW 1 11200032 missense probably damaging 0.99
R5331:Prex2 UTSW 1 11140011 missense possibly damaging 0.75
R5385:Prex2 UTSW 1 11139980 missense probably damaging 0.99
R5574:Prex2 UTSW 1 11140058 missense probably damaging 1.00
R5979:Prex2 UTSW 1 11132372 missense probably damaging 1.00
R6076:Prex2 UTSW 1 11185950 missense probably benign 0.09
R6160:Prex2 UTSW 1 10993851 missense probably damaging 1.00
R6177:Prex2 UTSW 1 11136777 missense possibly damaging 0.49
R6221:Prex2 UTSW 1 11266012 missense probably benign 0.01
R6293:Prex2 UTSW 1 11162298 missense probably benign
R6335:Prex2 UTSW 1 11110320 missense probably benign 0.13
R6401:Prex2 UTSW 1 11186727 missense probably benign 0.00
R6427:Prex2 UTSW 1 11182031 missense probably damaging 1.00
R6467:Prex2 UTSW 1 11266035 missense probably damaging 1.00
R6564:Prex2 UTSW 1 11101061 splice site probably null
R6734:Prex2 UTSW 1 11080059 missense probably damaging 1.00
R6753:Prex2 UTSW 1 11184456 missense probably damaging 0.98
R6880:Prex2 UTSW 1 11132384 missense probably damaging 1.00
R6973:Prex2 UTSW 1 11112743 missense probably damaging 1.00
R6980:Prex2 UTSW 1 11162263 missense probably benign 0.05
R6987:Prex2 UTSW 1 11170752 missense probably damaging 0.99
R7085:Prex2 UTSW 1 11098588 missense possibly damaging 0.73
R7101:Prex2 UTSW 1 11153609 missense possibly damaging 0.86
R7106:Prex2 UTSW 1 11136793 missense probably benign 0.33
R7319:Prex2 UTSW 1 11162308 missense probably benign 0.10
R7342:Prex2 UTSW 1 11162325 missense probably benign 0.00
R7469:Prex2 UTSW 1 11285069 missense probably damaging 1.00
R7528:Prex2 UTSW 1 11204092 missense probably damaging 1.00
R7592:Prex2 UTSW 1 11123213 missense probably damaging 1.00
R7650:Prex2 UTSW 1 11149854 missense possibly damaging 0.67
R7695:Prex2 UTSW 1 11162273 missense probably benign 0.00
R7733:Prex2 UTSW 1 11181959 missense probably benign 0.31
R7859:Prex2 UTSW 1 11080050 missense probably damaging 1.00
R8247:Prex2 UTSW 1 11199970 missense probably benign
R8300:Prex2 UTSW 1 11231718 missense possibly damaging 0.49
RF005:Prex2 UTSW 1 11185166 missense possibly damaging 0.47
Z1177:Prex2 UTSW 1 11289252 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACATGAAACACAGAAGCCTTTTGG -3'
(R):5'- GGTGATTACTTTGAGACAGCG -3'

Sequencing Primer
(F):5'- CACAGAAGCCTTTTGGAAATATTTG -3'
(R):5'- GTGATTACTTTGAGACAGCGATAAAC -3'
Posted On2019-11-12