Incidental Mutation 'R7720:Phf3'
ID 595152
Institutional Source Beutler Lab
Gene Symbol Phf3
Ensembl Gene ENSMUSG00000048874
Gene Name PHD finger protein 3
Synonyms AU020177, 2310061N19Rik
MMRRC Submission 067892-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7720 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 30841417-30912989 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 30868938 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 703 (K703N)
Ref Sequence ENSEMBL: ENSMUSP00000085650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000188780] [ENSMUST00000191064]
AlphaFold B2RQG2
Predicted Effect probably damaging
Transcript: ENSMUST00000088310
AA Change: K703N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874
AA Change: K703N

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186733
AA Change: K703N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874
AA Change: K703N

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188780
SMART Domains Protein: ENSMUSP00000140935
Gene: ENSMUSG00000048874

DomainStartEndE-ValueType
low complexity region 158 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191064
Meta Mutation Damage Score 0.2971 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 126,926,957 (GRCm39) D1018G probably damaging Het
Atm T C 9: 53,433,539 (GRCm39) N237S possibly damaging Het
Card6 G T 15: 5,127,905 (GRCm39) Q1164K unknown Het
Ccdc202 A G 14: 96,119,548 (GRCm39) R102G probably benign Het
Cped1 G A 6: 22,222,430 (GRCm39) C730Y probably damaging Het
Csmd1 A T 8: 15,981,108 (GRCm39) L2770Q probably damaging Het
Ctsw T C 19: 5,517,072 (GRCm39) T87A probably damaging Het
Dock4 T C 12: 40,856,974 (GRCm39) I1269T probably damaging Het
F11 T C 8: 45,705,127 (GRCm39) E138G possibly damaging Het
Fam124b A G 1: 80,177,974 (GRCm39) S342P probably damaging Het
Garin2 T C 12: 78,758,907 (GRCm39) S76P probably damaging Het
Gipr T C 7: 18,896,884 (GRCm39) I129V probably benign Het
Gria4 A T 9: 4,464,288 (GRCm39) V558D probably damaging Het
Gsdme C T 6: 50,206,288 (GRCm39) G185E probably damaging Het
Hapstr1 T A 16: 8,660,966 (GRCm39) C148S probably damaging Het
Hgd T A 16: 37,413,797 (GRCm39) D86E probably benign Het
Hmcn1 T A 1: 150,522,460 (GRCm39) H3480L probably benign Het
Hs2st1 T C 3: 144,159,783 (GRCm39) N127D probably damaging Het
Ilf3 A G 9: 21,310,833 (GRCm39) N599S possibly damaging Het
Itsn1 G A 16: 91,664,971 (GRCm39) G1132R unknown Het
Jakmip2 A G 18: 43,704,973 (GRCm39) S343P possibly damaging Het
Kif1b A G 4: 149,266,812 (GRCm39) V1670A probably benign Het
Lman2 A T 13: 55,500,890 (GRCm39) probably null Het
Ltbp1 A T 17: 75,692,119 (GRCm39) Y1579F probably damaging Het
Mon2 G A 10: 122,868,493 (GRCm39) A520V probably benign Het
Mrpl10 T G 11: 96,938,363 (GRCm39) V171G possibly damaging Het
Mrps27 A T 13: 99,537,838 (GRCm39) T153S unknown Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Nlrp10 A G 7: 108,523,695 (GRCm39) V595A probably benign Het
Nol4 A T 18: 23,173,080 (GRCm39) M7K probably benign Het
Oasl1 G A 5: 115,067,980 (GRCm39) S188N probably damaging Het
Or2d3c C A 7: 106,526,618 (GRCm39) G16V probably benign Het
Or5h25 T C 16: 58,930,134 (GRCm39) I280V probably benign Het
Pcdhga2 A G 18: 37,802,993 (GRCm39) Y279C probably damaging Het
Pfpl C T 19: 12,406,538 (GRCm39) A263V probably benign Het
Pik3ca C G 3: 32,490,367 (GRCm39) P5A probably damaging Het
Plekha6 T C 1: 133,221,445 (GRCm39) V987A probably damaging Het
Ppp3ca T A 3: 136,596,250 (GRCm39) I305N probably damaging Het
Prex2 A G 1: 11,252,161 (GRCm39) K1069E possibly damaging Het
Prss50 T C 9: 110,690,403 (GRCm39) V182A probably damaging Het
Ptprg A G 14: 12,211,703 (GRCm38) N995S probably benign Het
Robo2 C A 16: 73,693,903 (GRCm39) G1375V probably benign Het
Rtl1 T C 12: 109,560,864 (GRCm39) Y325C possibly damaging Het
Semp2l1 T C 1: 32,585,178 (GRCm39) D244G probably benign Het
Shcbp1 A C 8: 4,798,720 (GRCm39) S400A probably damaging Het
Shfl C T 9: 20,780,155 (GRCm39) probably benign Het
Sirpb1c T A 3: 15,886,236 (GRCm39) Y380F probably benign Het
Tbl2 G C 5: 135,188,329 (GRCm39) L374F probably damaging Het
Tpr C A 1: 150,305,283 (GRCm39) A1524E possibly damaging Het
Vmn2r45 T A 7: 8,486,460 (GRCm39) E276V probably damaging Het
Vps16 C T 2: 130,283,623 (GRCm39) Q606* probably null Het
Vstm5 A T 9: 15,150,652 (GRCm39) Q29L probably benign Het
Wipi1 G T 11: 109,473,249 (GRCm39) S250Y probably damaging Het
Other mutations in Phf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Phf3 APN 1 30,850,928 (GRCm39) missense probably damaging 0.99
IGL00704:Phf3 APN 1 30,843,919 (GRCm39) missense probably benign
IGL01147:Phf3 APN 1 30,843,250 (GRCm39) missense probably damaging 1.00
IGL01360:Phf3 APN 1 30,847,809 (GRCm39) missense probably damaging 1.00
IGL01376:Phf3 APN 1 30,869,566 (GRCm39) missense possibly damaging 0.62
IGL01396:Phf3 APN 1 30,843,386 (GRCm39) nonsense probably null
IGL01830:Phf3 APN 1 30,853,148 (GRCm39) nonsense probably null
IGL02108:Phf3 APN 1 30,869,032 (GRCm39) missense probably damaging 1.00
IGL02156:Phf3 APN 1 30,847,859 (GRCm39) missense probably damaging 1.00
IGL02576:Phf3 APN 1 30,869,117 (GRCm39) missense probably benign 0.01
IGL03031:Phf3 APN 1 30,843,734 (GRCm39) missense probably benign 0.00
IGL03334:Phf3 APN 1 30,844,810 (GRCm39) missense probably damaging 0.99
IGL03411:Phf3 APN 1 30,843,482 (GRCm39) missense probably damaging 1.00
FR4976:Phf3 UTSW 1 30,844,104 (GRCm39) utr 3 prime probably benign
PIT4458001:Phf3 UTSW 1 30,855,622 (GRCm39) missense probably damaging 1.00
R0037:Phf3 UTSW 1 30,843,999 (GRCm39) missense probably benign 0.03
R0052:Phf3 UTSW 1 30,847,848 (GRCm39) missense probably damaging 1.00
R0114:Phf3 UTSW 1 30,844,524 (GRCm39) missense possibly damaging 0.87
R0123:Phf3 UTSW 1 30,844,146 (GRCm39) missense probably benign 0.01
R0225:Phf3 UTSW 1 30,844,146 (GRCm39) missense probably benign 0.01
R0715:Phf3 UTSW 1 30,850,919 (GRCm39) missense probably damaging 1.00
R0835:Phf3 UTSW 1 30,869,632 (GRCm39) missense probably benign 0.02
R0848:Phf3 UTSW 1 30,902,253 (GRCm39) missense probably damaging 1.00
R1473:Phf3 UTSW 1 30,845,021 (GRCm39) missense probably damaging 1.00
R1522:Phf3 UTSW 1 30,844,729 (GRCm39) missense probably benign 0.05
R1549:Phf3 UTSW 1 30,843,923 (GRCm39) missense probably benign 0.00
R1555:Phf3 UTSW 1 30,844,958 (GRCm39) missense possibly damaging 0.86
R1780:Phf3 UTSW 1 30,851,023 (GRCm39) missense probably damaging 1.00
R1789:Phf3 UTSW 1 30,845,287 (GRCm39) missense probably damaging 1.00
R1875:Phf3 UTSW 1 30,869,704 (GRCm39) missense possibly damaging 0.81
R1912:Phf3 UTSW 1 30,843,426 (GRCm39) missense probably damaging 1.00
R1957:Phf3 UTSW 1 30,870,601 (GRCm39) missense probably damaging 1.00
R2019:Phf3 UTSW 1 30,850,928 (GRCm39) missense probably damaging 0.99
R2259:Phf3 UTSW 1 30,843,424 (GRCm39) missense probably benign 0.20
R2305:Phf3 UTSW 1 30,844,556 (GRCm39) nonsense probably null
R2345:Phf3 UTSW 1 30,844,432 (GRCm39) nonsense probably null
R2424:Phf3 UTSW 1 30,845,430 (GRCm39) missense probably damaging 1.00
R2497:Phf3 UTSW 1 30,869,095 (GRCm39) missense probably damaging 1.00
R2504:Phf3 UTSW 1 30,849,870 (GRCm39) missense probably damaging 1.00
R3522:Phf3 UTSW 1 30,844,684 (GRCm39) missense probably damaging 1.00
R3816:Phf3 UTSW 1 30,844,834 (GRCm39) missense probably damaging 1.00
R4152:Phf3 UTSW 1 30,870,539 (GRCm39) missense probably benign 0.13
R4403:Phf3 UTSW 1 30,843,490 (GRCm39) missense probably damaging 1.00
R4658:Phf3 UTSW 1 30,902,169 (GRCm39) missense probably damaging 1.00
R4663:Phf3 UTSW 1 30,860,296 (GRCm39) missense probably damaging 1.00
R4669:Phf3 UTSW 1 30,869,027 (GRCm39) missense probably damaging 1.00
R4706:Phf3 UTSW 1 30,844,687 (GRCm39) missense probably damaging 1.00
R4757:Phf3 UTSW 1 30,859,908 (GRCm39) missense probably damaging 1.00
R4766:Phf3 UTSW 1 30,853,020 (GRCm39) unclassified probably benign
R4786:Phf3 UTSW 1 30,855,638 (GRCm39) nonsense probably null
R5107:Phf3 UTSW 1 30,870,566 (GRCm39) missense probably benign 0.03
R5155:Phf3 UTSW 1 30,863,457 (GRCm39) missense possibly damaging 0.87
R5310:Phf3 UTSW 1 30,842,887 (GRCm39) missense probably damaging 1.00
R5823:Phf3 UTSW 1 30,843,764 (GRCm39) missense probably damaging 1.00
R5944:Phf3 UTSW 1 30,859,785 (GRCm39) missense probably damaging 1.00
R5979:Phf3 UTSW 1 30,844,827 (GRCm39) missense probably damaging 1.00
R6007:Phf3 UTSW 1 30,843,426 (GRCm39) missense probably damaging 1.00
R6024:Phf3 UTSW 1 30,902,307 (GRCm39) missense probably damaging 1.00
R6072:Phf3 UTSW 1 30,869,769 (GRCm39) missense probably benign 0.08
R6533:Phf3 UTSW 1 30,845,399 (GRCm39) missense probably damaging 1.00
R6649:Phf3 UTSW 1 30,844,104 (GRCm39) missense possibly damaging 0.75
R6653:Phf3 UTSW 1 30,844,104 (GRCm39) missense possibly damaging 0.75
R6852:Phf3 UTSW 1 30,843,711 (GRCm39) missense probably damaging 0.97
R6855:Phf3 UTSW 1 30,859,204 (GRCm39) missense probably damaging 1.00
R6862:Phf3 UTSW 1 30,853,063 (GRCm39) missense probably damaging 1.00
R6930:Phf3 UTSW 1 30,850,958 (GRCm39) missense probably damaging 1.00
R7135:Phf3 UTSW 1 30,870,190 (GRCm39) missense possibly damaging 0.61
R7323:Phf3 UTSW 1 30,852,211 (GRCm39) missense probably benign 0.01
R7352:Phf3 UTSW 1 30,843,407 (GRCm39) missense possibly damaging 0.87
R7455:Phf3 UTSW 1 30,876,239 (GRCm39) missense probably damaging 0.96
R7549:Phf3 UTSW 1 30,870,556 (GRCm39) missense probably benign 0.01
R7609:Phf3 UTSW 1 30,844,582 (GRCm39) missense probably benign 0.05
R7745:Phf3 UTSW 1 30,843,305 (GRCm39) missense probably damaging 1.00
R8134:Phf3 UTSW 1 30,863,552 (GRCm39) missense unknown
R8264:Phf3 UTSW 1 30,870,138 (GRCm39) missense possibly damaging 0.48
R8545:Phf3 UTSW 1 30,863,391 (GRCm39) missense possibly damaging 0.48
R8821:Phf3 UTSW 1 30,860,347 (GRCm39) nonsense probably null
R8831:Phf3 UTSW 1 30,860,347 (GRCm39) nonsense probably null
R8873:Phf3 UTSW 1 30,843,773 (GRCm39) missense possibly damaging 0.74
R9101:Phf3 UTSW 1 30,843,026 (GRCm39) missense possibly damaging 0.56
R9402:Phf3 UTSW 1 30,850,928 (GRCm39) missense probably damaging 0.99
R9426:Phf3 UTSW 1 30,870,625 (GRCm39) nonsense probably null
R9594:Phf3 UTSW 1 30,869,003 (GRCm39) missense probably benign 0.07
R9707:Phf3 UTSW 1 30,868,923 (GRCm39) critical splice donor site probably null
R9803:Phf3 UTSW 1 30,869,872 (GRCm39) missense probably benign 0.16
Z1177:Phf3 UTSW 1 30,851,049 (GRCm39) critical splice acceptor site probably null
Z1177:Phf3 UTSW 1 30,844,132 (GRCm39) missense unknown
Z1177:Phf3 UTSW 1 30,843,376 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATTTATCCAGGGTTGGTAAGG -3'
(R):5'- CCATCCAGTCAGTGAGCATC -3'

Sequencing Primer
(F):5'- GGTAAGGAGTTTTTGGAAGTCTC -3'
(R):5'- CATCCAGTCAGTGAGCATCTTAAGG -3'
Posted On 2019-11-12