Incidental Mutation 'R7720:Gm5415'
ID595153
Institutional Source Beutler Lab
Gene Symbol Gm5415
Ensembl Gene ENSMUSG00000091318
Gene Namepredicted gene 5415
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R7720 (G1)
Quality Score198.009
Status Not validated
Chromosome1
Chromosomal Location32543686-32547294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32546097 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 244 (D244G)
Ref Sequence ENSEMBL: ENSMUSP00000132789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027226] [ENSMUST00000171322]
Predicted Effect probably benign
Transcript: ENSMUST00000027226
SMART Domains Protein: ENSMUSP00000027226
Gene: ENSMUSG00000026058

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
KH 58 156 4.93e-7 SMART
low complexity region 185 197 N/A INTRINSIC
low complexity region 204 231 N/A INTRINSIC
Pfam:Sam68-YY 267 321 1.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171322
AA Change: D244G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132789
Gene: ENSMUSG00000091318
AA Change: D244G

DomainStartEndE-ValueType
low complexity region 137 150 N/A INTRINSIC
Pfam:Peptidase_C48 298 477 7.4e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,102 C148S probably damaging Het
4921530L21Rik A G 14: 95,882,112 R102G probably benign Het
A230050P20Rik C T 9: 20,868,859 probably benign Het
Agap2 A G 10: 127,091,088 D1018G probably damaging Het
Atm T C 9: 53,522,239 N237S possibly damaging Het
Card6 G T 15: 5,098,423 Q1164K unknown Het
Cped1 G A 6: 22,222,431 C730Y probably damaging Het
Csmd1 A T 8: 15,931,108 L2770Q probably damaging Het
Ctsw T C 19: 5,467,044 T87A probably damaging Het
Dock4 T C 12: 40,806,975 I1269T probably damaging Het
F11 T C 8: 45,252,090 E138G possibly damaging Het
Fam124b A G 1: 80,200,257 S342P probably damaging Het
Fam71d T C 12: 78,712,133 S76P probably damaging Het
Gipr T C 7: 19,162,959 I129V probably benign Het
Gria4 A T 9: 4,464,288 V558D probably damaging Het
Gsdme C T 6: 50,229,308 G185E probably damaging Het
Hgd T A 16: 37,593,435 D86E probably benign Het
Hmcn1 T A 1: 150,646,709 H3480L probably benign Het
Hs2st1 T C 3: 144,454,022 N127D probably damaging Het
Ilf3 A G 9: 21,399,537 N599S possibly damaging Het
Itsn1 G A 16: 91,868,083 G1132R unknown Het
Jakmip2 A G 18: 43,571,908 S343P possibly damaging Het
Kif1b A G 4: 149,182,355 V1670A probably benign Het
Lman2 A T 13: 55,353,077 probably null Het
Ltbp1 A T 17: 75,385,124 Y1579F probably damaging Het
Mon2 G A 10: 123,032,588 A520V probably benign Het
Mrpl10 T G 11: 97,047,537 V171G possibly damaging Het
Mrps27 A T 13: 99,401,330 T153S unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nlrp10 A G 7: 108,924,488 V595A probably benign Het
Nol4 A T 18: 23,040,023 M7K probably benign Het
Oasl1 G A 5: 114,929,921 S188N probably damaging Het
Olfr193 T C 16: 59,109,771 I280V probably benign Het
Olfr709-ps1 C A 7: 106,927,411 G16V probably benign Het
Pcdhga2 A G 18: 37,669,940 Y279C probably damaging Het
Pfpl C T 19: 12,429,174 A263V probably benign Het
Phf3 T G 1: 30,829,857 K703N probably damaging Het
Pik3ca C G 3: 32,436,218 P5A probably damaging Het
Plekha6 T C 1: 133,293,707 V987A probably damaging Het
Ppp3ca T A 3: 136,890,489 I305N probably damaging Het
Prex2 A G 1: 11,181,937 K1069E possibly damaging Het
Prss50 T C 9: 110,861,335 V182A probably damaging Het
Ptprg A G 14: 12,211,703 N995S probably benign Het
Robo2 C A 16: 73,897,015 G1375V probably benign Het
Rtl1 T C 12: 109,594,430 Y325C possibly damaging Het
Shcbp1 A C 8: 4,748,720 S400A probably damaging Het
Sirpb1c T A 3: 15,832,072 Y380F probably benign Het
Tbl2 G C 5: 135,159,475 L374F probably damaging Het
Tpr C A 1: 150,429,532 A1524E possibly damaging Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Vps16 C T 2: 130,441,703 Q606* probably null Het
Vstm5 A T 9: 15,239,356 Q29L probably benign Het
Wipi1 G T 11: 109,582,423 S250Y probably damaging Het
Other mutations in Gm5415
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Gm5415 APN 1 32546667 missense probably benign
IGL01148:Gm5415 APN 1 32545654 missense possibly damaging 0.88
IGL02323:Gm5415 APN 1 32545704 nonsense probably null
IGL03076:Gm5415 APN 1 32545545 missense probably damaging 1.00
IGL03288:Gm5415 APN 1 32545760 missense probably benign 0.09
PIT4576001:Gm5415 UTSW 1 32546472 missense probably damaging 1.00
R0110:Gm5415 UTSW 1 32545875 missense possibly damaging 0.87
R0510:Gm5415 UTSW 1 32545875 missense possibly damaging 0.87
R0891:Gm5415 UTSW 1 32546361 missense possibly damaging 0.54
R1836:Gm5415 UTSW 1 32545677 missense probably damaging 1.00
R1939:Gm5415 UTSW 1 32545546 missense probably damaging 0.99
R2156:Gm5415 UTSW 1 32546047 missense probably benign 0.08
R2226:Gm5415 UTSW 1 32545853 missense probably damaging 1.00
R2422:Gm5415 UTSW 1 32545861 missense possibly damaging 0.73
R4761:Gm5415 UTSW 1 32546507 missense possibly damaging 0.51
R4901:Gm5415 UTSW 1 32546620 missense probably benign 0.00
R5129:Gm5415 UTSW 1 32545479 missense probably damaging 1.00
R5129:Gm5415 UTSW 1 32545480 missense probably damaging 1.00
R5184:Gm5415 UTSW 1 32545648 missense probably damaging 0.99
R5259:Gm5415 UTSW 1 32545517 nonsense probably null
R6271:Gm5415 UTSW 1 32545491 missense probably damaging 1.00
R6589:Gm5415 UTSW 1 32546711 missense probably benign 0.44
R6746:Gm5415 UTSW 1 32546763 missense probably benign
R7855:Gm5415 UTSW 1 32546033 missense probably damaging 0.96
R7938:Gm5415 UTSW 1 32546033 missense probably damaging 0.96
R8006:Gm5415 UTSW 1 32546924 start gained probably benign
X0024:Gm5415 UTSW 1 32545711 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TGAGCCACTGACCATTCTTC -3'
(R):5'- CCATCTACTGTTGTGGCTCTAAAAG -3'

Sequencing Primer
(F):5'- GACCATTCTTCAGGGTCTGGATATC -3'
(R):5'- ATGTCTTTCACCAGACGAGAG -3'
Posted On2019-11-12