Incidental Mutation 'R7720:Fam124b'
ID 595154
Institutional Source Beutler Lab
Gene Symbol Fam124b
Ensembl Gene ENSMUSG00000043230
Gene Name family with sequence similarity 124, member B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R7720 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 80198706-80218473 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80200257 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 342 (S342P)
Ref Sequence ENSEMBL: ENSMUSP00000052208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058748]
AlphaFold Q8BLQ0
Predicted Effect probably damaging
Transcript: ENSMUST00000058748
AA Change: S342P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052208
Gene: ENSMUSG00000043230
AA Change: S342P

DomainStartEndE-ValueType
Pfam:FAM124 10 244 1.2e-107 PFAM
low complexity region 288 297 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,102 C148S probably damaging Het
4921530L21Rik A G 14: 95,882,112 R102G probably benign Het
A230050P20Rik C T 9: 20,868,859 probably benign Het
Agap2 A G 10: 127,091,088 D1018G probably damaging Het
Atm T C 9: 53,522,239 N237S possibly damaging Het
Card6 G T 15: 5,098,423 Q1164K unknown Het
Cped1 G A 6: 22,222,431 C730Y probably damaging Het
Csmd1 A T 8: 15,931,108 L2770Q probably damaging Het
Ctsw T C 19: 5,467,044 T87A probably damaging Het
Dock4 T C 12: 40,806,975 I1269T probably damaging Het
F11 T C 8: 45,252,090 E138G possibly damaging Het
Fam71d T C 12: 78,712,133 S76P probably damaging Het
Gipr T C 7: 19,162,959 I129V probably benign Het
Gm5415 T C 1: 32,546,097 D244G probably benign Het
Gria4 A T 9: 4,464,288 V558D probably damaging Het
Gsdme C T 6: 50,229,308 G185E probably damaging Het
Hgd T A 16: 37,593,435 D86E probably benign Het
Hmcn1 T A 1: 150,646,709 H3480L probably benign Het
Hs2st1 T C 3: 144,454,022 N127D probably damaging Het
Ilf3 A G 9: 21,399,537 N599S possibly damaging Het
Itsn1 G A 16: 91,868,083 G1132R unknown Het
Jakmip2 A G 18: 43,571,908 S343P possibly damaging Het
Kif1b A G 4: 149,182,355 V1670A probably benign Het
Lman2 A T 13: 55,353,077 probably null Het
Ltbp1 A T 17: 75,385,124 Y1579F probably damaging Het
Mon2 G A 10: 123,032,588 A520V probably benign Het
Mrpl10 T G 11: 97,047,537 V171G possibly damaging Het
Mrps27 A T 13: 99,401,330 T153S unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nlrp10 A G 7: 108,924,488 V595A probably benign Het
Nol4 A T 18: 23,040,023 M7K probably benign Het
Oasl1 G A 5: 114,929,921 S188N probably damaging Het
Olfr193 T C 16: 59,109,771 I280V probably benign Het
Olfr709-ps1 C A 7: 106,927,411 G16V probably benign Het
Pcdhga2 A G 18: 37,669,940 Y279C probably damaging Het
Pfpl C T 19: 12,429,174 A263V probably benign Het
Phf3 T G 1: 30,829,857 K703N probably damaging Het
Pik3ca C G 3: 32,436,218 P5A probably damaging Het
Plekha6 T C 1: 133,293,707 V987A probably damaging Het
Ppp3ca T A 3: 136,890,489 I305N probably damaging Het
Prex2 A G 1: 11,181,937 K1069E possibly damaging Het
Prss50 T C 9: 110,861,335 V182A probably damaging Het
Ptprg A G 14: 12,211,703 N995S probably benign Het
Robo2 C A 16: 73,897,015 G1375V probably benign Het
Rtl1 T C 12: 109,594,430 Y325C possibly damaging Het
Shcbp1 A C 8: 4,748,720 S400A probably damaging Het
Sirpb1c T A 3: 15,832,072 Y380F probably benign Het
Tbl2 G C 5: 135,159,475 L374F probably damaging Het
Tpr C A 1: 150,429,532 A1524E possibly damaging Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Vps16 C T 2: 130,441,703 Q606* probably null Het
Vstm5 A T 9: 15,239,356 Q29L probably benign Het
Wipi1 G T 11: 109,582,423 S250Y probably damaging Het
Other mutations in Fam124b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Fam124b APN 1 80213135 missense possibly damaging 0.95
IGL03384:Fam124b APN 1 80199956 missense probably benign
R0233:Fam124b UTSW 1 80212986 missense probably damaging 1.00
R0233:Fam124b UTSW 1 80212986 missense probably damaging 1.00
R1403:Fam124b UTSW 1 80213339 missense possibly damaging 0.57
R1403:Fam124b UTSW 1 80213339 missense possibly damaging 0.57
R1514:Fam124b UTSW 1 80200431 missense possibly damaging 0.82
R1569:Fam124b UTSW 1 80213135 missense possibly damaging 0.95
R1983:Fam124b UTSW 1 80213647 missense probably benign 0.03
R3104:Fam124b UTSW 1 80213031 missense probably damaging 1.00
R4640:Fam124b UTSW 1 80213526 missense probably damaging 1.00
R5014:Fam124b UTSW 1 80200059 missense probably benign 0.00
R6180:Fam124b UTSW 1 80200185 missense possibly damaging 0.71
R7618:Fam124b UTSW 1 80213837 start gained probably benign
R7682:Fam124b UTSW 1 80213565 missense possibly damaging 0.87
R7812:Fam124b UTSW 1 80213634 missense probably damaging 1.00
R7877:Fam124b UTSW 1 80213336 missense probably damaging 1.00
R7898:Fam124b UTSW 1 80213795 start gained probably benign
R7989:Fam124b UTSW 1 80213594 missense probably damaging 1.00
R8851:Fam124b UTSW 1 80213165 missense probably damaging 1.00
R9022:Fam124b UTSW 1 80212988 missense probably damaging 1.00
R9292:Fam124b UTSW 1 80213504 missense probably benign 0.04
R9607:Fam124b UTSW 1 80213096 missense probably damaging 1.00
T0975:Fam124b UTSW 1 80213126 missense probably benign 0.06
X0005:Fam124b UTSW 1 80213126 missense probably benign 0.06
X0062:Fam124b UTSW 1 80212961 missense probably damaging 1.00
Z1176:Fam124b UTSW 1 80213403 missense possibly damaging 0.58
Z1177:Fam124b UTSW 1 80200088 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTTTGGGGAAACAGTTACC -3'
(R):5'- CCACACAGAGAACCTTGGAG -3'

Sequencing Primer
(F):5'- TTTGGGGAAACAGTTACCTCTAAGG -3'
(R):5'- TTGGAGCCAAGGAGCCG -3'
Posted On 2019-11-12