Incidental Mutation 'R7720:Plekha6'
ID595155
Institutional Source Beutler Lab
Gene Symbol Plekha6
Ensembl Gene ENSMUSG00000041757
Gene Namepleckstrin homology domain containing, family A member 6
SynonymsPepp3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R7720 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location133164210-133303435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133293707 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 987 (V987A)
Ref Sequence ENSEMBL: ENSMUSP00000048214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038295] [ENSMUST00000105082] [ENSMUST00000186917] [ENSMUST00000187285]
Predicted Effect probably damaging
Transcript: ENSMUST00000038295
AA Change: V987A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048214
Gene: ENSMUSG00000041757
AA Change: V987A

DomainStartEndE-ValueType
PH 60 160 2.23e-20 SMART
low complexity region 217 231 N/A INTRINSIC
low complexity region 353 367 N/A INTRINSIC
Blast:PH 506 576 6e-31 BLAST
coiled coil region 613 686 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105082
AA Change: V883A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100703
Gene: ENSMUSG00000041757
AA Change: V883A

DomainStartEndE-ValueType
PH 60 180 1.24e-18 SMART
low complexity region 237 251 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
coiled coil region 559 632 N/A INTRINSIC
low complexity region 707 728 N/A INTRINSIC
low complexity region 1035 1049 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186917
AA Change: V883A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139794
Gene: ENSMUSG00000041757
AA Change: V883A

DomainStartEndE-ValueType
PH 60 180 1.24e-18 SMART
low complexity region 237 251 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
coiled coil region 559 632 N/A INTRINSIC
low complexity region 707 728 N/A INTRINSIC
low complexity region 1035 1049 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187285
AA Change: V862A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140558
Gene: ENSMUSG00000041757
AA Change: V862A

DomainStartEndE-ValueType
PH 60 160 9.6e-23 SMART
low complexity region 217 231 N/A INTRINSIC
low complexity region 353 367 N/A INTRINSIC
coiled coil region 539 612 N/A INTRINSIC
low complexity region 687 708 N/A INTRINSIC
low complexity region 1014 1028 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190186
AA Change: V714A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,102 C148S probably damaging Het
4921530L21Rik A G 14: 95,882,112 R102G probably benign Het
A230050P20Rik C T 9: 20,868,859 probably benign Het
Agap2 A G 10: 127,091,088 D1018G probably damaging Het
Atm T C 9: 53,522,239 N237S possibly damaging Het
Card6 G T 15: 5,098,423 Q1164K unknown Het
Cped1 G A 6: 22,222,431 C730Y probably damaging Het
Csmd1 A T 8: 15,931,108 L2770Q probably damaging Het
Ctsw T C 19: 5,467,044 T87A probably damaging Het
Dock4 T C 12: 40,806,975 I1269T probably damaging Het
F11 T C 8: 45,252,090 E138G possibly damaging Het
Fam124b A G 1: 80,200,257 S342P probably damaging Het
Fam71d T C 12: 78,712,133 S76P probably damaging Het
Gipr T C 7: 19,162,959 I129V probably benign Het
Gm5415 T C 1: 32,546,097 D244G probably benign Het
Gria4 A T 9: 4,464,288 V558D probably damaging Het
Gsdme C T 6: 50,229,308 G185E probably damaging Het
Hgd T A 16: 37,593,435 D86E probably benign Het
Hmcn1 T A 1: 150,646,709 H3480L probably benign Het
Hs2st1 T C 3: 144,454,022 N127D probably damaging Het
Ilf3 A G 9: 21,399,537 N599S possibly damaging Het
Itsn1 G A 16: 91,868,083 G1132R unknown Het
Jakmip2 A G 18: 43,571,908 S343P possibly damaging Het
Kif1b A G 4: 149,182,355 V1670A probably benign Het
Lman2 A T 13: 55,353,077 probably null Het
Ltbp1 A T 17: 75,385,124 Y1579F probably damaging Het
Mon2 G A 10: 123,032,588 A520V probably benign Het
Mrpl10 T G 11: 97,047,537 V171G possibly damaging Het
Mrps27 A T 13: 99,401,330 T153S unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nlrp10 A G 7: 108,924,488 V595A probably benign Het
Nol4 A T 18: 23,040,023 M7K probably benign Het
Oasl1 G A 5: 114,929,921 S188N probably damaging Het
Olfr193 T C 16: 59,109,771 I280V probably benign Het
Olfr709-ps1 C A 7: 106,927,411 G16V probably benign Het
Pcdhga2 A G 18: 37,669,940 Y279C probably damaging Het
Pfpl C T 19: 12,429,174 A263V probably benign Het
Phf3 T G 1: 30,829,857 K703N probably damaging Het
Pik3ca C G 3: 32,436,218 P5A probably damaging Het
Ppp3ca T A 3: 136,890,489 I305N probably damaging Het
Prex2 A G 1: 11,181,937 K1069E possibly damaging Het
Prss50 T C 9: 110,861,335 V182A probably damaging Het
Ptprg A G 14: 12,211,703 N995S probably benign Het
Robo2 C A 16: 73,897,015 G1375V probably benign Het
Rtl1 T C 12: 109,594,430 Y325C possibly damaging Het
Shcbp1 A C 8: 4,748,720 S400A probably damaging Het
Sirpb1c T A 3: 15,832,072 Y380F probably benign Het
Tbl2 G C 5: 135,159,475 L374F probably damaging Het
Tpr C A 1: 150,429,532 A1524E possibly damaging Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Vps16 C T 2: 130,441,703 Q606* probably null Het
Vstm5 A T 9: 15,239,356 Q29L probably benign Het
Wipi1 G T 11: 109,582,423 S250Y probably damaging Het
Other mutations in Plekha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Plekha6 APN 1 133282165 missense possibly damaging 0.92
IGL01328:Plekha6 APN 1 133272336 unclassified probably null
IGL01739:Plekha6 APN 1 133260131 missense probably benign 0.38
IGL01803:Plekha6 APN 1 133272414 nonsense probably null
IGL02053:Plekha6 APN 1 133272492 missense probably damaging 1.00
IGL02269:Plekha6 APN 1 133287849 missense possibly damaging 0.82
IGL02276:Plekha6 APN 1 133293861 missense possibly damaging 0.93
IGL02478:Plekha6 APN 1 133283293 missense probably benign 0.03
IGL02754:Plekha6 APN 1 133284938 missense probably damaging 0.98
R0100:Plekha6 UTSW 1 133270177 missense probably damaging 0.99
R0334:Plekha6 UTSW 1 133282180 missense probably benign 0.24
R0470:Plekha6 UTSW 1 133272307 missense probably benign 0.07
R1016:Plekha6 UTSW 1 133260094 missense probably benign 0.00
R1254:Plekha6 UTSW 1 133272589 missense probably benign 0.10
R1728:Plekha6 UTSW 1 133287846 missense probably benign
R1729:Plekha6 UTSW 1 133287846 missense probably benign
R1730:Plekha6 UTSW 1 133287846 missense probably benign
R1739:Plekha6 UTSW 1 133287846 missense probably benign
R1762:Plekha6 UTSW 1 133287846 missense probably benign
R1771:Plekha6 UTSW 1 133273913 missense probably benign 0.00
R1783:Plekha6 UTSW 1 133287846 missense probably benign
R1784:Plekha6 UTSW 1 133287846 missense probably benign
R1785:Plekha6 UTSW 1 133287846 missense probably benign
R1786:Plekha6 UTSW 1 133279365 intron probably null
R1997:Plekha6 UTSW 1 133263818 missense probably benign 0.43
R2020:Plekha6 UTSW 1 133284970 missense possibly damaging 0.55
R2130:Plekha6 UTSW 1 133279365 intron probably null
R2131:Plekha6 UTSW 1 133279365 intron probably null
R2133:Plekha6 UTSW 1 133279365 intron probably null
R2992:Plekha6 UTSW 1 133294658 missense probably damaging 1.00
R3781:Plekha6 UTSW 1 133294655 missense probably damaging 1.00
R3810:Plekha6 UTSW 1 133273979 missense probably benign
R4067:Plekha6 UTSW 1 133294678 missense probably benign 0.40
R4725:Plekha6 UTSW 1 133283320 missense probably damaging 1.00
R5657:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5658:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5746:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5768:Plekha6 UTSW 1 133280378 missense probably benign 0.01
R5785:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5892:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5937:Plekha6 UTSW 1 133260101 missense possibly damaging 0.89
R5985:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5986:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R6053:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R6072:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R6167:Plekha6 UTSW 1 133279407 missense probably null 0.96
R6843:Plekha6 UTSW 1 133274878 missense probably damaging 1.00
R6879:Plekha6 UTSW 1 133260055 missense possibly damaging 0.95
R6912:Plekha6 UTSW 1 133272535 missense probably benign 0.02
R6970:Plekha6 UTSW 1 133263818 missense probably benign 0.43
R7041:Plekha6 UTSW 1 133272460 missense possibly damaging 0.93
R7248:Plekha6 UTSW 1 133275848 nonsense probably null
R7400:Plekha6 UTSW 1 133274024 nonsense probably null
R7772:Plekha6 UTSW 1 133170022 missense possibly damaging 0.57
R8011:Plekha6 UTSW 1 133263806 missense probably benign
Z1176:Plekha6 UTSW 1 133263813 missense probably benign 0.00
Z1176:Plekha6 UTSW 1 133272471 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGATGAGGTCCTGTCTCTG -3'
(R):5'- TGTGGAGAGTCTAAGGTCACC -3'

Sequencing Primer
(F):5'- CTCTGGGCCTTGCTGTAG -3'
(R):5'- AGAGTCTAAGGTCACCGCCTG -3'
Posted On2019-11-12