Incidental Mutation 'R7720:Vps16'
ID 595159
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene Name VSP16 CORVET/HOPS core subunit
Synonyms 1810074M16Rik
MMRRC Submission 067892-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.970) question?
Stock # R7720 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 130266259-130286189 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 130283623 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 606 (Q606*)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000028900
AA Change: Q606*
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: Q606*

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 126,926,957 (GRCm39) D1018G probably damaging Het
Atm T C 9: 53,433,539 (GRCm39) N237S possibly damaging Het
Card6 G T 15: 5,127,905 (GRCm39) Q1164K unknown Het
Ccdc202 A G 14: 96,119,548 (GRCm39) R102G probably benign Het
Cped1 G A 6: 22,222,430 (GRCm39) C730Y probably damaging Het
Csmd1 A T 8: 15,981,108 (GRCm39) L2770Q probably damaging Het
Ctsw T C 19: 5,517,072 (GRCm39) T87A probably damaging Het
Dock4 T C 12: 40,856,974 (GRCm39) I1269T probably damaging Het
F11 T C 8: 45,705,127 (GRCm39) E138G possibly damaging Het
Fam124b A G 1: 80,177,974 (GRCm39) S342P probably damaging Het
Garin2 T C 12: 78,758,907 (GRCm39) S76P probably damaging Het
Gipr T C 7: 18,896,884 (GRCm39) I129V probably benign Het
Gria4 A T 9: 4,464,288 (GRCm39) V558D probably damaging Het
Gsdme C T 6: 50,206,288 (GRCm39) G185E probably damaging Het
Hapstr1 T A 16: 8,660,966 (GRCm39) C148S probably damaging Het
Hgd T A 16: 37,413,797 (GRCm39) D86E probably benign Het
Hmcn1 T A 1: 150,522,460 (GRCm39) H3480L probably benign Het
Hs2st1 T C 3: 144,159,783 (GRCm39) N127D probably damaging Het
Ilf3 A G 9: 21,310,833 (GRCm39) N599S possibly damaging Het
Itsn1 G A 16: 91,664,971 (GRCm39) G1132R unknown Het
Jakmip2 A G 18: 43,704,973 (GRCm39) S343P possibly damaging Het
Kif1b A G 4: 149,266,812 (GRCm39) V1670A probably benign Het
Lman2 A T 13: 55,500,890 (GRCm39) probably null Het
Ltbp1 A T 17: 75,692,119 (GRCm39) Y1579F probably damaging Het
Mon2 G A 10: 122,868,493 (GRCm39) A520V probably benign Het
Mrpl10 T G 11: 96,938,363 (GRCm39) V171G possibly damaging Het
Mrps27 A T 13: 99,537,838 (GRCm39) T153S unknown Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Nlrp10 A G 7: 108,523,695 (GRCm39) V595A probably benign Het
Nol4 A T 18: 23,173,080 (GRCm39) M7K probably benign Het
Oasl1 G A 5: 115,067,980 (GRCm39) S188N probably damaging Het
Or2d3c C A 7: 106,526,618 (GRCm39) G16V probably benign Het
Or5h25 T C 16: 58,930,134 (GRCm39) I280V probably benign Het
Pcdhga2 A G 18: 37,802,993 (GRCm39) Y279C probably damaging Het
Pfpl C T 19: 12,406,538 (GRCm39) A263V probably benign Het
Phf3 T G 1: 30,868,938 (GRCm39) K703N probably damaging Het
Pik3ca C G 3: 32,490,367 (GRCm39) P5A probably damaging Het
Plekha6 T C 1: 133,221,445 (GRCm39) V987A probably damaging Het
Ppp3ca T A 3: 136,596,250 (GRCm39) I305N probably damaging Het
Prex2 A G 1: 11,252,161 (GRCm39) K1069E possibly damaging Het
Prss50 T C 9: 110,690,403 (GRCm39) V182A probably damaging Het
Ptprg A G 14: 12,211,703 (GRCm38) N995S probably benign Het
Robo2 C A 16: 73,693,903 (GRCm39) G1375V probably benign Het
Rtl1 T C 12: 109,560,864 (GRCm39) Y325C possibly damaging Het
Semp2l1 T C 1: 32,585,178 (GRCm39) D244G probably benign Het
Shcbp1 A C 8: 4,798,720 (GRCm39) S400A probably damaging Het
Shfl C T 9: 20,780,155 (GRCm39) probably benign Het
Sirpb1c T A 3: 15,886,236 (GRCm39) Y380F probably benign Het
Tbl2 G C 5: 135,188,329 (GRCm39) L374F probably damaging Het
Tpr C A 1: 150,305,283 (GRCm39) A1524E possibly damaging Het
Vmn2r45 T A 7: 8,486,460 (GRCm39) E276V probably damaging Het
Vstm5 A T 9: 15,150,652 (GRCm39) Q29L probably benign Het
Wipi1 G T 11: 109,473,249 (GRCm39) S250Y probably damaging Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130,279,616 (GRCm39) missense probably benign 0.19
IGL01400:Vps16 APN 2 130,280,273 (GRCm39) missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130,280,314 (GRCm39) missense probably damaging 0.97
IGL02011:Vps16 APN 2 130,283,399 (GRCm39) missense probably benign 0.04
IGL02192:Vps16 APN 2 130,282,852 (GRCm39) missense probably damaging 0.98
IGL02220:Vps16 APN 2 130,283,573 (GRCm39) missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130,281,636 (GRCm39) critical splice donor site probably null
R0427:Vps16 UTSW 2 130,280,770 (GRCm39) missense probably benign 0.00
R0507:Vps16 UTSW 2 130,279,632 (GRCm39) critical splice donor site probably null
R1550:Vps16 UTSW 2 130,282,260 (GRCm39) missense probably benign 0.09
R1789:Vps16 UTSW 2 130,285,520 (GRCm39) missense probably benign 0.42
R3895:Vps16 UTSW 2 130,280,596 (GRCm39) missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130,284,514 (GRCm39) missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130,281,832 (GRCm39) missense probably damaging 1.00
R4555:Vps16 UTSW 2 130,285,496 (GRCm39) missense probably damaging 1.00
R4569:Vps16 UTSW 2 130,284,124 (GRCm39) missense probably benign
R4803:Vps16 UTSW 2 130,280,030 (GRCm39) missense probably benign 0.27
R4835:Vps16 UTSW 2 130,280,220 (GRCm39) splice site probably benign
R5022:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5023:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5057:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5158:Vps16 UTSW 2 130,283,199 (GRCm39) missense probably damaging 1.00
R5177:Vps16 UTSW 2 130,285,288 (GRCm39) nonsense probably null
R5540:Vps16 UTSW 2 130,284,305 (GRCm39) missense probably benign 0.00
R5680:Vps16 UTSW 2 130,282,244 (GRCm39) missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130,281,011 (GRCm39) nonsense probably null
R5690:Vps16 UTSW 2 130,281,011 (GRCm39) nonsense probably null
R5926:Vps16 UTSW 2 130,285,476 (GRCm39) missense probably damaging 0.97
R5992:Vps16 UTSW 2 130,266,369 (GRCm39) critical splice donor site probably null
R6135:Vps16 UTSW 2 130,280,573 (GRCm39) missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130,285,304 (GRCm39) missense probably damaging 1.00
R6898:Vps16 UTSW 2 130,279,601 (GRCm39) missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130,280,099 (GRCm39) missense probably damaging 1.00
R7487:Vps16 UTSW 2 130,280,977 (GRCm39) nonsense probably null
R7641:Vps16 UTSW 2 130,282,448 (GRCm39) missense probably benign 0.28
R8246:Vps16 UTSW 2 130,280,793 (GRCm39) missense probably damaging 1.00
R8363:Vps16 UTSW 2 130,284,161 (GRCm39) missense probably benign 0.08
R9092:Vps16 UTSW 2 130,281,593 (GRCm39) missense probably damaging 0.99
R9128:Vps16 UTSW 2 130,266,319 (GRCm39) missense possibly damaging 0.51
R9352:Vps16 UTSW 2 130,283,823 (GRCm39) critical splice donor site probably null
R9406:Vps16 UTSW 2 130,283,425 (GRCm39) critical splice donor site probably null
R9508:Vps16 UTSW 2 130,284,361 (GRCm39) missense possibly damaging 0.94
R9800:Vps16 UTSW 2 130,282,405 (GRCm39) missense probably benign 0.02
RF021:Vps16 UTSW 2 130,280,129 (GRCm39) missense probably benign 0.09
Z1177:Vps16 UTSW 2 130,283,346 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTGAGCAAGGCTATTGAG -3'
(R):5'- TGATGTGGAAGCTGCCCAAC -3'

Sequencing Primer
(F):5'- AGACACTGACCTGGGTGAGC -3'
(R):5'- GCCCAACTCCTGGTGATTG -3'
Posted On 2019-11-12