Incidental Mutation 'R7720:Hs2st1'
ID595163
Institutional Source Beutler Lab
Gene Symbol Hs2st1
Ensembl Gene ENSMUSG00000040151
Gene Nameheparan sulfate 2-O-sulfotransferase 1
SynonymsHs2st
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.688) question?
Stock #R7720 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location144429706-144570181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144454022 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 127 (N127D)
Ref Sequence ENSEMBL: ENSMUSP00000043066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043325] [ENSMUST00000160690]
Predicted Effect probably damaging
Transcript: ENSMUST00000043325
AA Change: N127D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043066
Gene: ENSMUSG00000040151
AA Change: N127D

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
Pfam:Sulfotransfer_2 66 327 9.1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160690
SMART Domains Protein: ENSMUSP00000123816
Gene: ENSMUSG00000040151

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. This gene encodes a member of the heparan sulfate biosynthetic enzyme family that transfers sulfate to the 2 position of the iduronic acid residue of heparan sulfate. The disruption of this gene resulted in no kidney formation in knockout embryonic mice, indicating that the absence of this enzyme may interfere with the signaling required for kidney formation. Two alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: A mutation in this gene causes bilateral renal agenesis, bone defects, eye development abnormalities and cataracts in homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,102 C148S probably damaging Het
4921530L21Rik A G 14: 95,882,112 R102G probably benign Het
A230050P20Rik C T 9: 20,868,859 probably benign Het
Agap2 A G 10: 127,091,088 D1018G probably damaging Het
Atm T C 9: 53,522,239 N237S possibly damaging Het
Card6 G T 15: 5,098,423 Q1164K unknown Het
Cped1 G A 6: 22,222,431 C730Y probably damaging Het
Csmd1 A T 8: 15,931,108 L2770Q probably damaging Het
Ctsw T C 19: 5,467,044 T87A probably damaging Het
Dock4 T C 12: 40,806,975 I1269T probably damaging Het
F11 T C 8: 45,252,090 E138G possibly damaging Het
Fam124b A G 1: 80,200,257 S342P probably damaging Het
Fam71d T C 12: 78,712,133 S76P probably damaging Het
Gipr T C 7: 19,162,959 I129V probably benign Het
Gm5415 T C 1: 32,546,097 D244G probably benign Het
Gria4 A T 9: 4,464,288 V558D probably damaging Het
Gsdme C T 6: 50,229,308 G185E probably damaging Het
Hgd T A 16: 37,593,435 D86E probably benign Het
Hmcn1 T A 1: 150,646,709 H3480L probably benign Het
Ilf3 A G 9: 21,399,537 N599S possibly damaging Het
Itsn1 G A 16: 91,868,083 G1132R unknown Het
Jakmip2 A G 18: 43,571,908 S343P possibly damaging Het
Kif1b A G 4: 149,182,355 V1670A probably benign Het
Lman2 A T 13: 55,353,077 probably null Het
Ltbp1 A T 17: 75,385,124 Y1579F probably damaging Het
Mon2 G A 10: 123,032,588 A520V probably benign Het
Mrpl10 T G 11: 97,047,537 V171G possibly damaging Het
Mrps27 A T 13: 99,401,330 T153S unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nlrp10 A G 7: 108,924,488 V595A probably benign Het
Nol4 A T 18: 23,040,023 M7K probably benign Het
Oasl1 G A 5: 114,929,921 S188N probably damaging Het
Olfr193 T C 16: 59,109,771 I280V probably benign Het
Olfr709-ps1 C A 7: 106,927,411 G16V probably benign Het
Pcdhga2 A G 18: 37,669,940 Y279C probably damaging Het
Pfpl C T 19: 12,429,174 A263V probably benign Het
Phf3 T G 1: 30,829,857 K703N probably damaging Het
Pik3ca C G 3: 32,436,218 P5A probably damaging Het
Plekha6 T C 1: 133,293,707 V987A probably damaging Het
Ppp3ca T A 3: 136,890,489 I305N probably damaging Het
Prex2 A G 1: 11,181,937 K1069E possibly damaging Het
Prss50 T C 9: 110,861,335 V182A probably damaging Het
Ptprg A G 14: 12,211,703 N995S probably benign Het
Robo2 C A 16: 73,897,015 G1375V probably benign Het
Rtl1 T C 12: 109,594,430 Y325C possibly damaging Het
Shcbp1 A C 8: 4,748,720 S400A probably damaging Het
Sirpb1c T A 3: 15,832,072 Y380F probably benign Het
Tbl2 G C 5: 135,159,475 L374F probably damaging Het
Tpr C A 1: 150,429,532 A1524E possibly damaging Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Vps16 C T 2: 130,441,703 Q606* probably null Het
Vstm5 A T 9: 15,239,356 Q29L probably benign Het
Wipi1 G T 11: 109,582,423 S250Y probably damaging Het
Other mutations in Hs2st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0037:Hs2st1 UTSW 3 144437644 nonsense probably null
R1215:Hs2st1 UTSW 3 144465141 missense possibly damaging 0.75
R1450:Hs2st1 UTSW 3 144434718 splice site probably benign
R1474:Hs2st1 UTSW 3 144435495 missense possibly damaging 0.94
R1505:Hs2st1 UTSW 3 144434561 missense probably benign 0.19
R1695:Hs2st1 UTSW 3 144434654 missense probably benign 0.00
R2511:Hs2st1 UTSW 3 144569930 unclassified probably benign
R2967:Hs2st1 UTSW 3 144465138 missense probably damaging 1.00
R3928:Hs2st1 UTSW 3 144434628 missense possibly damaging 0.55
R4895:Hs2st1 UTSW 3 144465253 missense probably benign
R4911:Hs2st1 UTSW 3 144465082 missense probably benign 0.23
R5477:Hs2st1 UTSW 3 144556948 critical splice donor site probably benign
R5666:Hs2st1 UTSW 3 144569793 missense probably damaging 0.97
R6262:Hs2st1 UTSW 3 144434613 missense probably damaging 0.96
R7230:Hs2st1 UTSW 3 144434546 missense probably benign
R7372:Hs2st1 UTSW 3 144435460 critical splice donor site probably null
R7492:Hs2st1 UTSW 3 144435596 missense probably benign 0.01
X0019:Hs2st1 UTSW 3 144454012 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCGAGACGTGTCCTTTTATGACC -3'
(R):5'- GTTCAGACTCCACTGACTGC -3'

Sequencing Primer
(F):5'- GACGTGTCCTTTTATGACCACTAGAG -3'
(R):5'- GACTGCTCTTACTTCAAACTGG -3'
Posted On2019-11-12