Incidental Mutation 'R7720:Oasl1'
ID595165
Institutional Source Beutler Lab
Gene Symbol Oasl1
Ensembl Gene ENSMUSG00000041827
Gene Name2'-5' oligoadenylate synthetase-like 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7720 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location114923240-114937915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 114929921 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 188 (S188N)
Ref Sequence ENSEMBL: ENSMUSP00000031540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031540] [ENSMUST00000112143]
Predicted Effect probably damaging
Transcript: ENSMUST00000031540
AA Change: S188N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031540
Gene: ENSMUSG00000041827
AA Change: S188N

DomainStartEndE-ValueType
low complexity region 31 42 N/A INTRINSIC
Pfam:OAS1_C 162 348 8e-76 PFAM
UBQ 350 425 1.58e0 SMART
UBQ 430 501 2.22e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112143
AA Change: S188N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107771
Gene: ENSMUSG00000041827
AA Change: S188N

DomainStartEndE-ValueType
low complexity region 31 42 N/A INTRINSIC
Pfam:OAS1_C 163 346 1.9e-79 PFAM
UBQ 350 425 1.58e0 SMART
UBQ 430 501 2.22e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Mice with a deletion of this gene have increased expression of type I interferon and show increased resistance to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,102 C148S probably damaging Het
4921530L21Rik A G 14: 95,882,112 R102G probably benign Het
A230050P20Rik C T 9: 20,868,859 probably benign Het
Agap2 A G 10: 127,091,088 D1018G probably damaging Het
Atm T C 9: 53,522,239 N237S possibly damaging Het
Card6 G T 15: 5,098,423 Q1164K unknown Het
Cped1 G A 6: 22,222,431 C730Y probably damaging Het
Csmd1 A T 8: 15,931,108 L2770Q probably damaging Het
Ctsw T C 19: 5,467,044 T87A probably damaging Het
Dock4 T C 12: 40,806,975 I1269T probably damaging Het
F11 T C 8: 45,252,090 E138G possibly damaging Het
Fam124b A G 1: 80,200,257 S342P probably damaging Het
Fam71d T C 12: 78,712,133 S76P probably damaging Het
Gipr T C 7: 19,162,959 I129V probably benign Het
Gm5415 T C 1: 32,546,097 D244G probably benign Het
Gria4 A T 9: 4,464,288 V558D probably damaging Het
Gsdme C T 6: 50,229,308 G185E probably damaging Het
Hgd T A 16: 37,593,435 D86E probably benign Het
Hmcn1 T A 1: 150,646,709 H3480L probably benign Het
Hs2st1 T C 3: 144,454,022 N127D probably damaging Het
Ilf3 A G 9: 21,399,537 N599S possibly damaging Het
Itsn1 G A 16: 91,868,083 G1132R unknown Het
Jakmip2 A G 18: 43,571,908 S343P possibly damaging Het
Kif1b A G 4: 149,182,355 V1670A probably benign Het
Lman2 A T 13: 55,353,077 probably null Het
Ltbp1 A T 17: 75,385,124 Y1579F probably damaging Het
Mon2 G A 10: 123,032,588 A520V probably benign Het
Mrpl10 T G 11: 97,047,537 V171G possibly damaging Het
Mrps27 A T 13: 99,401,330 T153S unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nlrp10 A G 7: 108,924,488 V595A probably benign Het
Nol4 A T 18: 23,040,023 M7K probably benign Het
Olfr193 T C 16: 59,109,771 I280V probably benign Het
Olfr709-ps1 C A 7: 106,927,411 G16V probably benign Het
Pcdhga2 A G 18: 37,669,940 Y279C probably damaging Het
Pfpl C T 19: 12,429,174 A263V probably benign Het
Phf3 T G 1: 30,829,857 K703N probably damaging Het
Pik3ca C G 3: 32,436,218 P5A probably damaging Het
Plekha6 T C 1: 133,293,707 V987A probably damaging Het
Ppp3ca T A 3: 136,890,489 I305N probably damaging Het
Prex2 A G 1: 11,181,937 K1069E possibly damaging Het
Prss50 T C 9: 110,861,335 V182A probably damaging Het
Ptprg A G 14: 12,211,703 N995S probably benign Het
Robo2 C A 16: 73,897,015 G1375V probably benign Het
Rtl1 T C 12: 109,594,430 Y325C possibly damaging Het
Shcbp1 A C 8: 4,748,720 S400A probably damaging Het
Sirpb1c T A 3: 15,832,072 Y380F probably benign Het
Tbl2 G C 5: 135,159,475 L374F probably damaging Het
Tpr C A 1: 150,429,532 A1524E possibly damaging Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Vps16 C T 2: 130,441,703 Q606* probably null Het
Vstm5 A T 9: 15,239,356 Q29L probably benign Het
Wipi1 G T 11: 109,582,423 S250Y probably damaging Het
Other mutations in Oasl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Oasl1 APN 5 114937407 missense probably benign 0.01
IGL02061:Oasl1 APN 5 114923592 missense probably damaging 0.97
IGL02888:Oasl1 APN 5 114937182 missense probably damaging 1.00
IGL03230:Oasl1 APN 5 114937056 missense probably damaging 1.00
dreadnaught UTSW 5 114936070 critical splice donor site probably null
nautilus UTSW 5 114937183 missense probably damaging 1.00
IGL03048:Oasl1 UTSW 5 114937341 missense possibly damaging 0.56
R1510:Oasl1 UTSW 5 114928108 missense probably benign 0.00
R1680:Oasl1 UTSW 5 114935944 missense probably damaging 1.00
R1918:Oasl1 UTSW 5 114923469 missense possibly damaging 0.84
R2090:Oasl1 UTSW 5 114935934 missense probably damaging 1.00
R3977:Oasl1 UTSW 5 114932898 missense probably damaging 1.00
R3978:Oasl1 UTSW 5 114932898 missense probably damaging 1.00
R3980:Oasl1 UTSW 5 114932898 missense probably damaging 1.00
R4158:Oasl1 UTSW 5 114937014 missense possibly damaging 0.77
R4159:Oasl1 UTSW 5 114937014 missense possibly damaging 0.77
R4160:Oasl1 UTSW 5 114937014 missense possibly damaging 0.77
R4161:Oasl1 UTSW 5 114937014 missense possibly damaging 0.77
R4797:Oasl1 UTSW 5 114928158 missense probably benign 0.00
R5354:Oasl1 UTSW 5 114936996 missense probably damaging 1.00
R5443:Oasl1 UTSW 5 114936070 critical splice donor site probably null
R5820:Oasl1 UTSW 5 114936978 missense possibly damaging 0.94
R5919:Oasl1 UTSW 5 114928270 missense probably damaging 1.00
R6746:Oasl1 UTSW 5 114937183 missense probably damaging 1.00
R7471:Oasl1 UTSW 5 114935926 missense probably damaging 1.00
R7766:Oasl1 UTSW 5 114937110 missense probably damaging 1.00
Z1177:Oasl1 UTSW 5 114932745 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATAATCTAACGAGTGACCAGGC -3'
(R):5'- CGTTCACAAACCACAGGAGTG -3'

Sequencing Primer
(F):5'- GCCCTCCCAAAATGCCTACTTAG -3'
(R):5'- TCAGCCCAGGAACAGTATCTG -3'
Posted On2019-11-12