Mutagenetix > Incidental Mutations

Incidental Mutation 'R7720:Oasl1'

595165

Institutional Source

Beutler Lab

Gene Symbol

Oasl1

Ensembl Gene

ENSMUSG00000041827

Gene Name

2'-5' oligoadenylate synthetase-like 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7720 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114923240-114937915 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 114929921 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 188 (S188N)

Ref Sequence

ENSEMBL: ENSMUSP00000031540 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031540] [ENSMUST00000112143]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031540
AA Change: S188N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000031540
Gene: ENSMUSG00000041827
AA Change: S188N

Domain	Start	End	E-Value	Type
low complexity region	31	42	N/A	INTRINSIC
Pfam:OAS1_C	162	348	8e-76	PFAM
UBQ	350	425	1.58e0	SMART
UBQ	430	501	2.22e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112143
AA Change: S188N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000107771
Gene: ENSMUSG00000041827
AA Change: S188N

Domain	Start	End	E-Value	Type
low complexity region	31	42	N/A	INTRINSIC
Pfam:OAS1_C	163	346	1.9e-79	PFAM
UBQ	350	425	1.58e0	SMART
UBQ	430	501	2.22e-11	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

PHENOTYPE: Mice with a deletion of this gene have increased expression of type I interferon and show increased resistance to viral infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	T	A	16: 8,843,102	C148S	probably damaging	Het
4921530L21Rik	A	G	14: 95,882,112	R102G	probably benign	Het
A230050P20Rik	C	T	9: 20,868,859		probably benign	Het
Agap2	A	G	10: 127,091,088	D1018G	probably damaging	Het
Atm	T	C	9: 53,522,239	N237S	possibly damaging	Het
Card6	G	T	15: 5,098,423	Q1164K	unknown	Het
Cped1	G	A	6: 22,222,431	C730Y	probably damaging	Het
Csmd1	A	T	8: 15,931,108	L2770Q	probably damaging	Het
Ctsw	T	C	19: 5,467,044	T87A	probably damaging	Het
Dock4	T	C	12: 40,806,975	I1269T	probably damaging	Het
F11	T	C	8: 45,252,090	E138G	possibly damaging	Het
Fam124b	A	G	1: 80,200,257	S342P	probably damaging	Het
Fam71d	T	C	12: 78,712,133	S76P	probably damaging	Het
Gipr	T	C	7: 19,162,959	I129V	probably benign	Het
Gm5415	T	C	1: 32,546,097	D244G	probably benign	Het
Gria4	A	T	9: 4,464,288	V558D	probably damaging	Het
Gsdme	C	T	6: 50,229,308	G185E	probably damaging	Het
Hgd	T	A	16: 37,593,435	D86E	probably benign	Het
Hmcn1	T	A	1: 150,646,709	H3480L	probably benign	Het
Hs2st1	T	C	3: 144,454,022	N127D	probably damaging	Het
Ilf3	A	G	9: 21,399,537	N599S	possibly damaging	Het
Itsn1	G	A	16: 91,868,083	G1132R	unknown	Het
Jakmip2	A	G	18: 43,571,908	S343P	possibly damaging	Het
Kif1b	A	G	4: 149,182,355	V1670A	probably benign	Het
Lman2	A	T	13: 55,353,077		probably null	Het
Ltbp1	A	T	17: 75,385,124	Y1579F	probably damaging	Het
Mon2	G	A	10: 123,032,588	A520V	probably benign	Het
Mrpl10	T	G	11: 97,047,537	V171G	possibly damaging	Het
Mrps27	A	T	13: 99,401,330	T153S	unknown	Het
Muc5ac	G	C	7: 141,809,303	G2117A	unknown	Het
Nlrp10	A	G	7: 108,924,488	V595A	probably benign	Het
Nol4	A	T	18: 23,040,023	M7K	probably benign	Het
Olfr193	T	C	16: 59,109,771	I280V	probably benign	Het
Olfr709-ps1	C	A	7: 106,927,411	G16V	probably benign	Het
Pcdhga2	A	G	18: 37,669,940	Y279C	probably damaging	Het
Pfpl	C	T	19: 12,429,174	A263V	probably benign	Het
Phf3	T	G	1: 30,829,857	K703N	probably damaging	Het
Pik3ca	C	G	3: 32,436,218	P5A	probably damaging	Het
Plekha6	T	C	1: 133,293,707	V987A	probably damaging	Het
Ppp3ca	T	A	3: 136,890,489	I305N	probably damaging	Het
Prex2	A	G	1: 11,181,937	K1069E	possibly damaging	Het
Prss50	T	C	9: 110,861,335	V182A	probably damaging	Het
Ptprg	A	G	14: 12,211,703	N995S	probably benign	Het
Robo2	C	A	16: 73,897,015	G1375V	probably benign	Het
Rtl1	T	C	12: 109,594,430	Y325C	possibly damaging	Het
Shcbp1	A	C	8: 4,748,720	S400A	probably damaging	Het
Sirpb1c	T	A	3: 15,832,072	Y380F	probably benign	Het
Tbl2	G	C	5: 135,159,475	L374F	probably damaging	Het
Tpr	C	A	1: 150,429,532	A1524E	possibly damaging	Het
Vmn2r45	T	A	7: 8,483,461	E276V	probably damaging	Het
Vps16	C	T	2: 130,441,703	Q606*	probably null	Het
Vstm5	A	T	9: 15,239,356	Q29L	probably benign	Het
Wipi1	G	T	11: 109,582,423	S250Y	probably damaging	Het

Other mutations in Oasl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01432:Oasl1	APN	5	114937407	missense	probably benign	0.01
IGL02061:Oasl1	APN	5	114923592	missense	probably damaging	0.97
IGL02888:Oasl1	APN	5	114937182	missense	probably damaging	1.00
IGL03230:Oasl1	APN	5	114937056	missense	probably damaging	1.00
ammonite	UTSW	5	114936937	missense	probably damaging	1.00
dreadnaught	UTSW	5	114936070	critical splice donor site	probably null
nautilus	UTSW	5	114937183	missense	probably damaging	1.00
spirogyra	UTSW	5	114937406	missense	probably benign	0.00
IGL03048:Oasl1	UTSW	5	114937341	missense	possibly damaging	0.56
R1510:Oasl1	UTSW	5	114928108	missense	probably benign	0.00
R1680:Oasl1	UTSW	5	114935944	missense	probably damaging	1.00
R1918:Oasl1	UTSW	5	114923469	missense	possibly damaging	0.84
R2090:Oasl1	UTSW	5	114935934	missense	probably damaging	1.00
R3977:Oasl1	UTSW	5	114932898	missense	probably damaging	1.00
R3978:Oasl1	UTSW	5	114932898	missense	probably damaging	1.00
R3980:Oasl1	UTSW	5	114932898	missense	probably damaging	1.00
R4158:Oasl1	UTSW	5	114937014	missense	possibly damaging	0.77
R4159:Oasl1	UTSW	5	114937014	missense	possibly damaging	0.77
R4160:Oasl1	UTSW	5	114937014	missense	possibly damaging	0.77
R4161:Oasl1	UTSW	5	114937014	missense	possibly damaging	0.77
R4797:Oasl1	UTSW	5	114928158	missense	probably benign	0.00
R5354:Oasl1	UTSW	5	114936996	missense	probably damaging	1.00
R5443:Oasl1	UTSW	5	114936070	critical splice donor site	probably null
R5820:Oasl1	UTSW	5	114936978	missense	possibly damaging	0.94
R5919:Oasl1	UTSW	5	114928270	missense	probably damaging	1.00
R6746:Oasl1	UTSW	5	114937183	missense	probably damaging	1.00
R7471:Oasl1	UTSW	5	114935926	missense	probably damaging	1.00
R7766:Oasl1	UTSW	5	114937110	missense	probably damaging	1.00
R8115:Oasl1	UTSW	5	114936937	missense	probably damaging	1.00
R8243:Oasl1	UTSW	5	114928161	missense	probably benign	0.04
R8358:Oasl1	UTSW	5	114937406	missense	probably benign	0.00
Z1177:Oasl1	UTSW	5	114932745	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- ATAATCTAACGAGTGACCAGGC -3'
(R):5'- CGTTCACAAACCACAGGAGTG -3'

Sequencing Primer
(F):5'- GCCCTCCCAAAATGCCTACTTAG -3'
(R):5'- TCAGCCCAGGAACAGTATCTG -3'

Posted On

2019-11-12