Mutagenetix > Incidental Mutation

Incidental Mutation 'R7720:Cped1'

595167

Institutional Source

Beutler Lab

Gene Symbol

Cped1

Ensembl Gene

ENSMUSG00000062980

Gene Name

cadherin-like and PC-esterase domain containing 1

Synonyms

A430107O13Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R7720 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21985916-22256404 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 22222431 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 730 (C730Y)

Ref Sequence

ENSEMBL: ENSMUSP00000111041 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115383]

AlphaFold

B2RX70

Predicted Effect

probably damaging
Transcript: ENSMUST00000115383
AA Change: C730Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000111041
Gene: ENSMUSG00000062980
AA Change: C730Y

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	110	122	N/A	INTRINSIC
low complexity region	133	147	N/A	INTRINSIC
Pfam:Cadherin-like	574	663	1e-9	PFAM
Pfam:PC-Esterase	753	1018	2e-26	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119808
Gene: ENSMUSG00000062980
AA Change: C592Y

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	110	122	N/A	INTRINSIC
low complexity region	133	147	N/A	INTRINSIC
Pfam:Cadherin-like	570	663	6.2e-12	PFAM
Pfam:PC-Esterase	753	963	1.6e-33	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	T	A	16: 8,843,102	C148S	probably damaging	Het
4921530L21Rik	A	G	14: 95,882,112	R102G	probably benign	Het
A230050P20Rik	C	T	9: 20,868,859		probably benign	Het
Agap2	A	G	10: 127,091,088	D1018G	probably damaging	Het
Atm	T	C	9: 53,522,239	N237S	possibly damaging	Het
Card6	G	T	15: 5,098,423	Q1164K	unknown	Het
Csmd1	A	T	8: 15,931,108	L2770Q	probably damaging	Het
Ctsw	T	C	19: 5,467,044	T87A	probably damaging	Het
Dock4	T	C	12: 40,806,975	I1269T	probably damaging	Het
F11	T	C	8: 45,252,090	E138G	possibly damaging	Het
Fam124b	A	G	1: 80,200,257	S342P	probably damaging	Het
Fam71d	T	C	12: 78,712,133	S76P	probably damaging	Het
Gipr	T	C	7: 19,162,959	I129V	probably benign	Het
Gm5415	T	C	1: 32,546,097	D244G	probably benign	Het
Gria4	A	T	9: 4,464,288	V558D	probably damaging	Het
Gsdme	C	T	6: 50,229,308	G185E	probably damaging	Het
Hgd	T	A	16: 37,593,435	D86E	probably benign	Het
Hmcn1	T	A	1: 150,646,709	H3480L	probably benign	Het
Hs2st1	T	C	3: 144,454,022	N127D	probably damaging	Het
Ilf3	A	G	9: 21,399,537	N599S	possibly damaging	Het
Itsn1	G	A	16: 91,868,083	G1132R	unknown	Het
Jakmip2	A	G	18: 43,571,908	S343P	possibly damaging	Het
Kif1b	A	G	4: 149,182,355	V1670A	probably benign	Het
Lman2	A	T	13: 55,353,077		probably null	Het
Ltbp1	A	T	17: 75,385,124	Y1579F	probably damaging	Het
Mon2	G	A	10: 123,032,588	A520V	probably benign	Het
Mrpl10	T	G	11: 97,047,537	V171G	possibly damaging	Het
Mrps27	A	T	13: 99,401,330	T153S	unknown	Het
Muc5ac	G	C	7: 141,809,303	G2117A	unknown	Het
Nlrp10	A	G	7: 108,924,488	V595A	probably benign	Het
Nol4	A	T	18: 23,040,023	M7K	probably benign	Het
Oasl1	G	A	5: 114,929,921	S188N	probably damaging	Het
Olfr193	T	C	16: 59,109,771	I280V	probably benign	Het
Olfr709-ps1	C	A	7: 106,927,411	G16V	probably benign	Het
Pcdhga2	A	G	18: 37,669,940	Y279C	probably damaging	Het
Pfpl	C	T	19: 12,429,174	A263V	probably benign	Het
Phf3	T	G	1: 30,829,857	K703N	probably damaging	Het
Pik3ca	C	G	3: 32,436,218	P5A	probably damaging	Het
Plekha6	T	C	1: 133,293,707	V987A	probably damaging	Het
Ppp3ca	T	A	3: 136,890,489	I305N	probably damaging	Het
Prex2	A	G	1: 11,181,937	K1069E	possibly damaging	Het
Prss50	T	C	9: 110,861,335	V182A	probably damaging	Het
Ptprg	A	G	14: 12,211,703	N995S	probably benign	Het
Robo2	C	A	16: 73,897,015	G1375V	probably benign	Het
Rtl1	T	C	12: 109,594,430	Y325C	possibly damaging	Het
Shcbp1	A	C	8: 4,748,720	S400A	probably damaging	Het
Sirpb1c	T	A	3: 15,832,072	Y380F	probably benign	Het
Tbl2	G	C	5: 135,159,475	L374F	probably damaging	Het
Tpr	C	A	1: 150,429,532	A1524E	possibly damaging	Het
Vmn2r45	T	A	7: 8,483,461	E276V	probably damaging	Het
Vps16	C	T	2: 130,441,703	Q606*	probably null	Het
Vstm5	A	T	9: 15,239,356	Q29L	probably benign	Het
Wipi1	G	T	11: 109,582,423	S250Y	probably damaging	Het

Other mutations in Cped1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cped1	APN	6	22215523	missense	probably damaging	1.00
IGL00909:Cped1	APN	6	22122427	splice site	probably benign
IGL01434:Cped1	APN	6	22017005	missense	probably damaging	0.99
IGL01572:Cped1	APN	6	22051301	missense	probably benign	0.00
IGL02063:Cped1	APN	6	22138702	missense	probably damaging	0.98
IGL02216:Cped1	APN	6	22059945	missense	probably damaging	1.00
IGL02257:Cped1	APN	6	22145607	missense	possibly damaging	0.86
IGL02541:Cped1	APN	6	22120989	missense	probably benign	0.00
IGL03008:Cped1	APN	6	22233602	missense	probably benign	0.01
IGL03237:Cped1	APN	6	22233596	missense	probably damaging	1.00
PIT4382001:Cped1	UTSW	6	22222450	nonsense	probably null
PIT4812001:Cped1	UTSW	6	22122294	missense	probably benign	0.02
R0048:Cped1	UTSW	6	22119602	missense	probably benign	0.08
R0128:Cped1	UTSW	6	22121039	missense	probably benign	0.00
R0130:Cped1	UTSW	6	22121039	missense	probably benign	0.00
R0267:Cped1	UTSW	6	22119476	missense	probably damaging	0.99
R0374:Cped1	UTSW	6	22222546	splice site	probably benign
R0482:Cped1	UTSW	6	22016958	missense	probably benign	0.32
R0734:Cped1	UTSW	6	22085041	missense	probably damaging	1.00
R1033:Cped1	UTSW	6	22016951	missense	probably damaging	0.99
R1118:Cped1	UTSW	6	22237699	missense	probably benign	0.19
R1181:Cped1	UTSW	6	22215562	missense	probably damaging	0.99
R1300:Cped1	UTSW	6	22119553	missense	probably benign	0.00
R1485:Cped1	UTSW	6	22132388	critical splice donor site	probably null
R1507:Cped1	UTSW	6	22122261	missense	probably damaging	1.00
R1830:Cped1	UTSW	6	22237728	missense	probably damaging	1.00
R1879:Cped1	UTSW	6	22085015	splice site	probably null
R1902:Cped1	UTSW	6	22120981	splice site	probably null
R1991:Cped1	UTSW	6	22233927	missense	probably damaging	1.00
R2020:Cped1	UTSW	6	22143964	missense	probably benign	0.38
R2883:Cped1	UTSW	6	22143979	missense	probably damaging	1.00
R3011:Cped1	UTSW	6	22088696	missense	probably damaging	1.00
R4466:Cped1	UTSW	6	22123652	missense	probably benign	0.29
R4668:Cped1	UTSW	6	22237653	missense	probably benign	0.06
R4808:Cped1	UTSW	6	22088757	missense	probably damaging	1.00
R5402:Cped1	UTSW	6	22143952	missense	probably benign	0.05
R5417:Cped1	UTSW	6	22233580	missense	probably null	0.01
R5741:Cped1	UTSW	6	22123621	missense	probably benign	0.02
R5821:Cped1	UTSW	6	22138682	missense	probably benign	0.00
R5977:Cped1	UTSW	6	22254608	missense	probably damaging	1.00
R6255:Cped1	UTSW	6	22138715	splice site	probably null
R6304:Cped1	UTSW	6	22016923	missense	probably benign	0.14
R6416:Cped1	UTSW	6	22123649	missense	probably damaging	1.00
R6444:Cped1	UTSW	6	21986931	missense	probably benign	0.00
R6617:Cped1	UTSW	6	22215547	nonsense	probably null
R6650:Cped1	UTSW	6	22233976	missense	probably damaging	1.00
R7048:Cped1	UTSW	6	22119470	missense	probably benign	0.36
R7083:Cped1	UTSW	6	22123580	missense	probably benign	0.01
R7234:Cped1	UTSW	6	22254626	missense	probably damaging	0.99
R7387:Cped1	UTSW	6	22059934	missense	probably benign	0.01
R7493:Cped1	UTSW	6	22215513	missense	probably damaging	1.00
R7747:Cped1	UTSW	6	22143974	missense	probably damaging	1.00
R7966:Cped1	UTSW	6	22059954	critical splice donor site	probably null
R8113:Cped1	UTSW	6	22233481	missense	possibly damaging	0.89
R8186:Cped1	UTSW	6	22123588	missense	probably benign	0.01
R8215:Cped1	UTSW	6	22132278	missense	probably damaging	1.00
R8265:Cped1	UTSW	6	22222427	missense	probably benign	0.04
R8280:Cped1	UTSW	6	21986821	missense	unknown
R8286:Cped1	UTSW	6	22254602	missense	probably benign	0.03
R8393:Cped1	UTSW	6	22222466	missense	possibly damaging	0.80
R8503:Cped1	UTSW	6	22145565	missense	probably benign	0.02
R8725:Cped1	UTSW	6	22059942	missense	possibly damaging	0.71
R8727:Cped1	UTSW	6	22059942	missense	possibly damaging	0.71
R8852:Cped1	UTSW	6	22215621	missense	probably damaging	1.00
R8881:Cped1	UTSW	6	22119579	missense	possibly damaging	0.58
R8888:Cped1	UTSW	6	22016963	missense	possibly damaging	0.51
R8983:Cped1	UTSW	6	22138687	missense	probably benign	0.00
R9135:Cped1	UTSW	6	21987013	missense	probably damaging	0.98
X0022:Cped1	UTSW	6	21987046	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GAACAGTGTTATTTCACAACAGGAC -3'
(R):5'- ACATGCAATGGTCTGGCCTC -3'

Sequencing Primer
(F):5'- TCTCTGCTTGACTCACAGGAGG -3'
(R):5'- TCTGGCCTCAGTGCTGAAGAC -3'

Posted On

2019-11-12