Incidental Mutation 'R7720:Cped1'
ID595167
Institutional Source Beutler Lab
Gene Symbol Cped1
Ensembl Gene ENSMUSG00000062980
Gene Namecadherin-like and PC-esterase domain containing 1
SynonymsA430107O13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7720 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location21985916-22256404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22222431 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 730 (C730Y)
Ref Sequence ENSEMBL: ENSMUSP00000111041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115383]
Predicted Effect probably damaging
Transcript: ENSMUST00000115383
AA Change: C730Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111041
Gene: ENSMUSG00000062980
AA Change: C730Y

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Pfam:Cadherin-like 574 663 1e-9 PFAM
Pfam:PC-Esterase 753 1018 2e-26 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119808
Gene: ENSMUSG00000062980
AA Change: C592Y

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Pfam:Cadherin-like 570 663 6.2e-12 PFAM
Pfam:PC-Esterase 753 963 1.6e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,102 C148S probably damaging Het
4921530L21Rik A G 14: 95,882,112 R102G probably benign Het
A230050P20Rik C T 9: 20,868,859 probably benign Het
Agap2 A G 10: 127,091,088 D1018G probably damaging Het
Atm T C 9: 53,522,239 N237S possibly damaging Het
Card6 G T 15: 5,098,423 Q1164K unknown Het
Csmd1 A T 8: 15,931,108 L2770Q probably damaging Het
Ctsw T C 19: 5,467,044 T87A probably damaging Het
Dock4 T C 12: 40,806,975 I1269T probably damaging Het
F11 T C 8: 45,252,090 E138G possibly damaging Het
Fam124b A G 1: 80,200,257 S342P probably damaging Het
Fam71d T C 12: 78,712,133 S76P probably damaging Het
Gipr T C 7: 19,162,959 I129V probably benign Het
Gm5415 T C 1: 32,546,097 D244G probably benign Het
Gria4 A T 9: 4,464,288 V558D probably damaging Het
Gsdme C T 6: 50,229,308 G185E probably damaging Het
Hgd T A 16: 37,593,435 D86E probably benign Het
Hmcn1 T A 1: 150,646,709 H3480L probably benign Het
Hs2st1 T C 3: 144,454,022 N127D probably damaging Het
Ilf3 A G 9: 21,399,537 N599S possibly damaging Het
Itsn1 G A 16: 91,868,083 G1132R unknown Het
Jakmip2 A G 18: 43,571,908 S343P possibly damaging Het
Kif1b A G 4: 149,182,355 V1670A probably benign Het
Lman2 A T 13: 55,353,077 probably null Het
Ltbp1 A T 17: 75,385,124 Y1579F probably damaging Het
Mon2 G A 10: 123,032,588 A520V probably benign Het
Mrpl10 T G 11: 97,047,537 V171G possibly damaging Het
Mrps27 A T 13: 99,401,330 T153S unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nlrp10 A G 7: 108,924,488 V595A probably benign Het
Nol4 A T 18: 23,040,023 M7K probably benign Het
Oasl1 G A 5: 114,929,921 S188N probably damaging Het
Olfr193 T C 16: 59,109,771 I280V probably benign Het
Olfr709-ps1 C A 7: 106,927,411 G16V probably benign Het
Pcdhga2 A G 18: 37,669,940 Y279C probably damaging Het
Pfpl C T 19: 12,429,174 A263V probably benign Het
Phf3 T G 1: 30,829,857 K703N probably damaging Het
Pik3ca C G 3: 32,436,218 P5A probably damaging Het
Plekha6 T C 1: 133,293,707 V987A probably damaging Het
Ppp3ca T A 3: 136,890,489 I305N probably damaging Het
Prex2 A G 1: 11,181,937 K1069E possibly damaging Het
Prss50 T C 9: 110,861,335 V182A probably damaging Het
Ptprg A G 14: 12,211,703 N995S probably benign Het
Robo2 C A 16: 73,897,015 G1375V probably benign Het
Rtl1 T C 12: 109,594,430 Y325C possibly damaging Het
Shcbp1 A C 8: 4,748,720 S400A probably damaging Het
Sirpb1c T A 3: 15,832,072 Y380F probably benign Het
Tbl2 G C 5: 135,159,475 L374F probably damaging Het
Tpr C A 1: 150,429,532 A1524E possibly damaging Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Vps16 C T 2: 130,441,703 Q606* probably null Het
Vstm5 A T 9: 15,239,356 Q29L probably benign Het
Wipi1 G T 11: 109,582,423 S250Y probably damaging Het
Other mutations in Cped1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cped1 APN 6 22215523 missense probably damaging 1.00
IGL00909:Cped1 APN 6 22122427 splice site probably benign
IGL01434:Cped1 APN 6 22017005 missense probably damaging 0.99
IGL01572:Cped1 APN 6 22051301 missense probably benign 0.00
IGL02063:Cped1 APN 6 22138702 missense probably damaging 0.98
IGL02216:Cped1 APN 6 22059945 missense probably damaging 1.00
IGL02257:Cped1 APN 6 22145607 missense possibly damaging 0.86
IGL02541:Cped1 APN 6 22120989 missense probably benign 0.00
IGL03008:Cped1 APN 6 22233602 missense probably benign 0.01
IGL03237:Cped1 APN 6 22233596 missense probably damaging 1.00
PIT4382001:Cped1 UTSW 6 22222450 nonsense probably null
PIT4812001:Cped1 UTSW 6 22122294 missense probably benign 0.02
R0048:Cped1 UTSW 6 22119602 missense probably benign 0.08
R0128:Cped1 UTSW 6 22121039 missense probably benign 0.00
R0130:Cped1 UTSW 6 22121039 missense probably benign 0.00
R0267:Cped1 UTSW 6 22119476 missense probably damaging 0.99
R0374:Cped1 UTSW 6 22222546 splice site probably benign
R0482:Cped1 UTSW 6 22016958 missense probably benign 0.32
R0734:Cped1 UTSW 6 22085041 missense probably damaging 1.00
R1033:Cped1 UTSW 6 22016951 missense probably damaging 0.99
R1118:Cped1 UTSW 6 22237699 missense probably benign 0.19
R1181:Cped1 UTSW 6 22215562 missense probably damaging 0.99
R1300:Cped1 UTSW 6 22119553 missense probably benign 0.00
R1485:Cped1 UTSW 6 22132388 critical splice donor site probably null
R1507:Cped1 UTSW 6 22122261 missense probably damaging 1.00
R1830:Cped1 UTSW 6 22237728 missense probably damaging 1.00
R1879:Cped1 UTSW 6 22085015 splice site probably null
R1902:Cped1 UTSW 6 22120981 splice site probably null
R1991:Cped1 UTSW 6 22233927 missense probably damaging 1.00
R2020:Cped1 UTSW 6 22143964 missense probably benign 0.38
R2883:Cped1 UTSW 6 22143979 missense probably damaging 1.00
R3011:Cped1 UTSW 6 22088696 missense probably damaging 1.00
R4466:Cped1 UTSW 6 22123652 missense probably benign 0.29
R4668:Cped1 UTSW 6 22237653 missense probably benign 0.06
R4808:Cped1 UTSW 6 22088757 missense probably damaging 1.00
R5402:Cped1 UTSW 6 22143952 missense probably benign 0.05
R5417:Cped1 UTSW 6 22233580 missense probably null 0.01
R5741:Cped1 UTSW 6 22123621 missense probably benign 0.02
R5821:Cped1 UTSW 6 22138682 missense probably benign 0.00
R5977:Cped1 UTSW 6 22254608 missense probably damaging 1.00
R6255:Cped1 UTSW 6 22138715 splice site probably null
R6304:Cped1 UTSW 6 22016923 missense probably benign 0.14
R6416:Cped1 UTSW 6 22123649 missense probably damaging 1.00
R6444:Cped1 UTSW 6 21986931 missense probably benign 0.00
R6617:Cped1 UTSW 6 22215547 nonsense probably null
R6650:Cped1 UTSW 6 22233976 missense probably damaging 1.00
R7048:Cped1 UTSW 6 22119470 missense probably benign 0.36
R7083:Cped1 UTSW 6 22123580 missense probably benign 0.01
R7234:Cped1 UTSW 6 22254626 missense probably damaging 0.99
R7387:Cped1 UTSW 6 22059934 missense probably benign 0.01
R7493:Cped1 UTSW 6 22215513 missense probably damaging 1.00
R7747:Cped1 UTSW 6 22143974 missense probably damaging 1.00
R7966:Cped1 UTSW 6 22059954 critical splice donor site probably null
R8113:Cped1 UTSW 6 22233481 missense possibly damaging 0.89
R8186:Cped1 UTSW 6 22123588 missense probably benign 0.01
R8215:Cped1 UTSW 6 22132278 missense probably damaging 1.00
R8265:Cped1 UTSW 6 22222427 missense probably benign 0.04
R8280:Cped1 UTSW 6 21986821 missense unknown
R8286:Cped1 UTSW 6 22254602 missense probably benign 0.03
R8393:Cped1 UTSW 6 22222466 missense possibly damaging 0.80
R8503:Cped1 UTSW 6 22145565 missense probably benign 0.02
R8725:Cped1 UTSW 6 22059942 missense possibly damaging 0.71
R8727:Cped1 UTSW 6 22059942 missense possibly damaging 0.71
R8852:Cped1 UTSW 6 22215621 missense probably damaging 1.00
R8881:Cped1 UTSW 6 22119579 missense possibly damaging 0.58
R8888:Cped1 UTSW 6 22016963 missense possibly damaging 0.51
X0022:Cped1 UTSW 6 21987046 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAACAGTGTTATTTCACAACAGGAC -3'
(R):5'- ACATGCAATGGTCTGGCCTC -3'

Sequencing Primer
(F):5'- TCTCTGCTTGACTCACAGGAGG -3'
(R):5'- TCTGGCCTCAGTGCTGAAGAC -3'
Posted On2019-11-12