Incidental Mutation 'R7720:Nlrp10'
ID 595172
Institutional Source Beutler Lab
Gene Symbol Nlrp10
Ensembl Gene ENSMUSG00000049709
Gene Name NLR family, pyrin domain containing 10
Synonyms Nalp10, 6430548I20Rik, Pynod
MMRRC Submission 067892-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7720 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 108521060-108529365 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108523695 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 595 (V595A)
Ref Sequence ENSEMBL: ENSMUSP00000050252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055745]
AlphaFold Q8CCN1
PDB Structure Solution structure of the Pyrin/PAAD-DAPIN domain in mouse NALP10 (NACHT, leucine rich repeat and PYD containing 10) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000055745
AA Change: V595A

PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000050252
Gene: ENSMUSG00000049709
AA Change: V595A

DomainStartEndE-ValueType
PYRIN 9 88 4.13e-18 SMART
low complexity region 126 137 N/A INTRINSIC
AAA 161 302 1.07e-2 SMART
low complexity region 576 597 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). The protein encoded by this gene belongs to the NALP protein family despite lacking the LRR region. This protein likely plays a regulatory role in the innate immune system. The protein belongs to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. Other experiments indicate that this gene acts as a multifunctional negative regulator of inflammation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a global defect in adaptive immune responses with impaired dendritic cell migration to lymph nodes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 126,926,957 (GRCm39) D1018G probably damaging Het
Atm T C 9: 53,433,539 (GRCm39) N237S possibly damaging Het
Card6 G T 15: 5,127,905 (GRCm39) Q1164K unknown Het
Ccdc202 A G 14: 96,119,548 (GRCm39) R102G probably benign Het
Cped1 G A 6: 22,222,430 (GRCm39) C730Y probably damaging Het
Csmd1 A T 8: 15,981,108 (GRCm39) L2770Q probably damaging Het
Ctsw T C 19: 5,517,072 (GRCm39) T87A probably damaging Het
Dock4 T C 12: 40,856,974 (GRCm39) I1269T probably damaging Het
F11 T C 8: 45,705,127 (GRCm39) E138G possibly damaging Het
Fam124b A G 1: 80,177,974 (GRCm39) S342P probably damaging Het
Garin2 T C 12: 78,758,907 (GRCm39) S76P probably damaging Het
Gipr T C 7: 18,896,884 (GRCm39) I129V probably benign Het
Gria4 A T 9: 4,464,288 (GRCm39) V558D probably damaging Het
Gsdme C T 6: 50,206,288 (GRCm39) G185E probably damaging Het
Hapstr1 T A 16: 8,660,966 (GRCm39) C148S probably damaging Het
Hgd T A 16: 37,413,797 (GRCm39) D86E probably benign Het
Hmcn1 T A 1: 150,522,460 (GRCm39) H3480L probably benign Het
Hs2st1 T C 3: 144,159,783 (GRCm39) N127D probably damaging Het
Ilf3 A G 9: 21,310,833 (GRCm39) N599S possibly damaging Het
Itsn1 G A 16: 91,664,971 (GRCm39) G1132R unknown Het
Jakmip2 A G 18: 43,704,973 (GRCm39) S343P possibly damaging Het
Kif1b A G 4: 149,266,812 (GRCm39) V1670A probably benign Het
Lman2 A T 13: 55,500,890 (GRCm39) probably null Het
Ltbp1 A T 17: 75,692,119 (GRCm39) Y1579F probably damaging Het
Mon2 G A 10: 122,868,493 (GRCm39) A520V probably benign Het
Mrpl10 T G 11: 96,938,363 (GRCm39) V171G possibly damaging Het
Mrps27 A T 13: 99,537,838 (GRCm39) T153S unknown Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Nol4 A T 18: 23,173,080 (GRCm39) M7K probably benign Het
Oasl1 G A 5: 115,067,980 (GRCm39) S188N probably damaging Het
Or2d3c C A 7: 106,526,618 (GRCm39) G16V probably benign Het
Or5h25 T C 16: 58,930,134 (GRCm39) I280V probably benign Het
Pcdhga2 A G 18: 37,802,993 (GRCm39) Y279C probably damaging Het
Pfpl C T 19: 12,406,538 (GRCm39) A263V probably benign Het
Phf3 T G 1: 30,868,938 (GRCm39) K703N probably damaging Het
Pik3ca C G 3: 32,490,367 (GRCm39) P5A probably damaging Het
Plekha6 T C 1: 133,221,445 (GRCm39) V987A probably damaging Het
Ppp3ca T A 3: 136,596,250 (GRCm39) I305N probably damaging Het
Prex2 A G 1: 11,252,161 (GRCm39) K1069E possibly damaging Het
Prss50 T C 9: 110,690,403 (GRCm39) V182A probably damaging Het
Ptprg A G 14: 12,211,703 (GRCm38) N995S probably benign Het
Robo2 C A 16: 73,693,903 (GRCm39) G1375V probably benign Het
Rtl1 T C 12: 109,560,864 (GRCm39) Y325C possibly damaging Het
Semp2l1 T C 1: 32,585,178 (GRCm39) D244G probably benign Het
Shcbp1 A C 8: 4,798,720 (GRCm39) S400A probably damaging Het
Shfl C T 9: 20,780,155 (GRCm39) probably benign Het
Sirpb1c T A 3: 15,886,236 (GRCm39) Y380F probably benign Het
Tbl2 G C 5: 135,188,329 (GRCm39) L374F probably damaging Het
Tpr C A 1: 150,305,283 (GRCm39) A1524E possibly damaging Het
Vmn2r45 T A 7: 8,486,460 (GRCm39) E276V probably damaging Het
Vps16 C T 2: 130,283,623 (GRCm39) Q606* probably null Het
Vstm5 A T 9: 15,150,652 (GRCm39) Q29L probably benign Het
Wipi1 G T 11: 109,473,249 (GRCm39) S250Y probably damaging Het
Other mutations in Nlrp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Nlrp10 APN 7 108,523,788 (GRCm39) missense possibly damaging 0.86
IGL01482:Nlrp10 APN 7 108,526,159 (GRCm39) missense probably benign
IGL02043:Nlrp10 APN 7 108,524,709 (GRCm39) missense probably damaging 0.99
IGL03129:Nlrp10 APN 7 108,524,118 (GRCm39) missense probably damaging 1.00
IGL02835:Nlrp10 UTSW 7 108,523,869 (GRCm39) missense possibly damaging 0.61
R0106:Nlrp10 UTSW 7 108,524,529 (GRCm39) missense possibly damaging 0.94
R0106:Nlrp10 UTSW 7 108,524,529 (GRCm39) missense possibly damaging 0.94
R0540:Nlrp10 UTSW 7 108,523,492 (GRCm39) missense probably benign 0.26
R0607:Nlrp10 UTSW 7 108,523,492 (GRCm39) missense probably benign 0.26
R1166:Nlrp10 UTSW 7 108,524,217 (GRCm39) missense probably damaging 1.00
R1248:Nlrp10 UTSW 7 108,525,088 (GRCm39) missense probably benign 0.08
R1450:Nlrp10 UTSW 7 108,524,595 (GRCm39) missense probably damaging 0.98
R1459:Nlrp10 UTSW 7 108,523,555 (GRCm39) missense probably benign
R1567:Nlrp10 UTSW 7 108,526,257 (GRCm39) missense probably benign 0.02
R1635:Nlrp10 UTSW 7 108,523,737 (GRCm39) missense possibly damaging 0.93
R1845:Nlrp10 UTSW 7 108,526,248 (GRCm39) missense probably damaging 1.00
R1912:Nlrp10 UTSW 7 108,524,602 (GRCm39) nonsense probably null
R1952:Nlrp10 UTSW 7 108,523,770 (GRCm39) missense probably benign 0.20
R1953:Nlrp10 UTSW 7 108,524,325 (GRCm39) missense probably benign 0.00
R2079:Nlrp10 UTSW 7 108,524,835 (GRCm39) missense possibly damaging 0.66
R3615:Nlrp10 UTSW 7 108,523,683 (GRCm39) missense probably benign
R3616:Nlrp10 UTSW 7 108,523,683 (GRCm39) missense probably benign
R4207:Nlrp10 UTSW 7 108,523,548 (GRCm39) missense possibly damaging 0.56
R4786:Nlrp10 UTSW 7 108,524,445 (GRCm39) missense probably damaging 1.00
R5048:Nlrp10 UTSW 7 108,523,772 (GRCm39) missense probably benign 0.01
R5568:Nlrp10 UTSW 7 108,523,468 (GRCm39) missense probably benign 0.00
R5993:Nlrp10 UTSW 7 108,526,220 (GRCm39) missense probably benign 0.00
R6033:Nlrp10 UTSW 7 108,523,784 (GRCm39) missense probably benign 0.17
R6033:Nlrp10 UTSW 7 108,523,784 (GRCm39) missense probably benign 0.17
R6170:Nlrp10 UTSW 7 108,523,671 (GRCm39) missense probably benign 0.00
R6320:Nlrp10 UTSW 7 108,524,953 (GRCm39) missense possibly damaging 0.82
R6935:Nlrp10 UTSW 7 108,526,107 (GRCm39) missense probably damaging 0.99
R7024:Nlrp10 UTSW 7 108,524,405 (GRCm39) missense possibly damaging 0.73
R7081:Nlrp10 UTSW 7 108,523,855 (GRCm39) missense probably benign 0.02
R7397:Nlrp10 UTSW 7 108,523,899 (GRCm39) missense probably damaging 1.00
R7763:Nlrp10 UTSW 7 108,525,033 (GRCm39) missense probably damaging 0.99
R7776:Nlrp10 UTSW 7 108,524,656 (GRCm39) missense probably damaging 1.00
R7823:Nlrp10 UTSW 7 108,523,468 (GRCm39) missense probably benign 0.00
R7852:Nlrp10 UTSW 7 108,524,281 (GRCm39) missense probably damaging 1.00
R8272:Nlrp10 UTSW 7 108,525,103 (GRCm39) missense probably benign 0.00
R9181:Nlrp10 UTSW 7 108,524,108 (GRCm39) missense probably damaging 0.99
R9712:Nlrp10 UTSW 7 108,524,735 (GRCm39) missense probably damaging 1.00
Z1177:Nlrp10 UTSW 7 108,525,058 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACATGCTAAGACTCCTGG -3'
(R):5'- TACAAAAGGTCATGGGATCTGG -3'

Sequencing Primer
(F):5'- AAGTGTCTGTCCTTCCTCATC -3'
(R):5'- AAAGGTCATGGGATCTGGAATTCTC -3'
Posted On 2019-11-12