Mutagenetix > Incidental Mutation

Incidental Mutation 'R7720:Shcbp1'

595174

Institutional Source

Beutler Lab

Gene Symbol

Shcbp1

Ensembl Gene

ENSMUSG00000022322

Gene Name

Shc SH2-domain binding protein 1

Synonyms

mPAL

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7720 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4735976-4779567 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 4748720 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 400 (S400A)

Ref Sequence

ENSEMBL: ENSMUSP00000022945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022945]

AlphaFold

Q9Z179

Predicted Effect

probably damaging
Transcript: ENSMUST00000022945
AA Change: S400A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000022945
Gene: ENSMUSG00000022322
AA Change: S400A

Domain	Start	End	E-Value	Type
low complexity region	210	219	N/A	INTRINSIC
low complexity region	262	275	N/A	INTRINSIC
PbH1	428	451	8.61e3	SMART
PbH1	452	473	2.38e3	SMART
PbH1	474	496	9.62e2	SMART
PbH1	497	518	1.07e2	SMART
PbH1	526	548	1.74e2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000207262

Predicted Effect

Meta Mutation Damage Score

0.4711

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal viability, fertility and T cell development but show decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	T	A	16: 8,843,102	C148S	probably damaging	Het
4921530L21Rik	A	G	14: 95,882,112	R102G	probably benign	Het
A230050P20Rik	C	T	9: 20,868,859		probably benign	Het
Agap2	A	G	10: 127,091,088	D1018G	probably damaging	Het
Atm	T	C	9: 53,522,239	N237S	possibly damaging	Het
Card6	G	T	15: 5,098,423	Q1164K	unknown	Het
Cped1	G	A	6: 22,222,431	C730Y	probably damaging	Het
Csmd1	A	T	8: 15,931,108	L2770Q	probably damaging	Het
Ctsw	T	C	19: 5,467,044	T87A	probably damaging	Het
Dock4	T	C	12: 40,806,975	I1269T	probably damaging	Het
F11	T	C	8: 45,252,090	E138G	possibly damaging	Het
Fam124b	A	G	1: 80,200,257	S342P	probably damaging	Het
Fam71d	T	C	12: 78,712,133	S76P	probably damaging	Het
Gipr	T	C	7: 19,162,959	I129V	probably benign	Het
Gm5415	T	C	1: 32,546,097	D244G	probably benign	Het
Gria4	A	T	9: 4,464,288	V558D	probably damaging	Het
Gsdme	C	T	6: 50,229,308	G185E	probably damaging	Het
Hgd	T	A	16: 37,593,435	D86E	probably benign	Het
Hmcn1	T	A	1: 150,646,709	H3480L	probably benign	Het
Hs2st1	T	C	3: 144,454,022	N127D	probably damaging	Het
Ilf3	A	G	9: 21,399,537	N599S	possibly damaging	Het
Itsn1	G	A	16: 91,868,083	G1132R	unknown	Het
Jakmip2	A	G	18: 43,571,908	S343P	possibly damaging	Het
Kif1b	A	G	4: 149,182,355	V1670A	probably benign	Het
Lman2	A	T	13: 55,353,077		probably null	Het
Ltbp1	A	T	17: 75,385,124	Y1579F	probably damaging	Het
Mon2	G	A	10: 123,032,588	A520V	probably benign	Het
Mrpl10	T	G	11: 97,047,537	V171G	possibly damaging	Het
Mrps27	A	T	13: 99,401,330	T153S	unknown	Het
Muc5ac	G	C	7: 141,809,303	G2117A	unknown	Het
Nlrp10	A	G	7: 108,924,488	V595A	probably benign	Het
Nol4	A	T	18: 23,040,023	M7K	probably benign	Het
Oasl1	G	A	5: 114,929,921	S188N	probably damaging	Het
Olfr193	T	C	16: 59,109,771	I280V	probably benign	Het
Olfr709-ps1	C	A	7: 106,927,411	G16V	probably benign	Het
Pcdhga2	A	G	18: 37,669,940	Y279C	probably damaging	Het
Pfpl	C	T	19: 12,429,174	A263V	probably benign	Het
Phf3	T	G	1: 30,829,857	K703N	probably damaging	Het
Pik3ca	C	G	3: 32,436,218	P5A	probably damaging	Het
Plekha6	T	C	1: 133,293,707	V987A	probably damaging	Het
Ppp3ca	T	A	3: 136,890,489	I305N	probably damaging	Het
Prex2	A	G	1: 11,181,937	K1069E	possibly damaging	Het
Prss50	T	C	9: 110,861,335	V182A	probably damaging	Het
Ptprg	A	G	14: 12,211,703	N995S	probably benign	Het
Robo2	C	A	16: 73,897,015	G1375V	probably benign	Het
Rtl1	T	C	12: 109,594,430	Y325C	possibly damaging	Het
Sirpb1c	T	A	3: 15,832,072	Y380F	probably benign	Het
Tbl2	G	C	5: 135,159,475	L374F	probably damaging	Het
Tpr	C	A	1: 150,429,532	A1524E	possibly damaging	Het
Vmn2r45	T	A	7: 8,483,461	E276V	probably damaging	Het
Vps16	C	T	2: 130,441,703	Q606*	probably null	Het
Vstm5	A	T	9: 15,239,356	Q29L	probably benign	Het
Wipi1	G	T	11: 109,582,423	S250Y	probably damaging	Het

Other mutations in Shcbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Shcbp1	APN	8	4754258	nonsense	probably null
IGL01330:Shcbp1	APN	8	4736372	missense	probably benign	0.00
IGL01878:Shcbp1	APN	8	4749721	missense	probably damaging	0.98
IGL02415:Shcbp1	APN	8	4754239	missense	possibly damaging	0.93
IGL02559:Shcbp1	APN	8	4749305	missense	probably damaging	0.98
IGL03171:Shcbp1	APN	8	4739166	missense	probably benign	0.05
IGL03348:Shcbp1	APN	8	4765089	missense	probably benign	0.10
R0102:Shcbp1	UTSW	8	4744452	missense	probably damaging	1.00
R0102:Shcbp1	UTSW	8	4744452	missense	probably damaging	1.00
R0729:Shcbp1	UTSW	8	4736297	missense	probably benign	0.05
R0743:Shcbp1	UTSW	8	4764906	missense	probably benign
R1413:Shcbp1	UTSW	8	4741968	critical splice acceptor site	probably null
R1630:Shcbp1	UTSW	8	4748763	nonsense	probably null
R1645:Shcbp1	UTSW	8	4749645	missense	probably benign	0.00
R3778:Shcbp1	UTSW	8	4736295	missense	probably benign	0.01
R4066:Shcbp1	UTSW	8	4748716	missense	probably damaging	0.98
R4232:Shcbp1	UTSW	8	4736372	missense	probably benign	0.06
R4524:Shcbp1	UTSW	8	4739193	missense	probably damaging	1.00
R4552:Shcbp1	UTSW	8	4749779	nonsense	probably null
R4623:Shcbp1	UTSW	8	4739178	missense	probably damaging	1.00
R4748:Shcbp1	UTSW	8	4744512	missense	probably damaging	1.00
R5093:Shcbp1	UTSW	8	4739214	missense	possibly damaging	0.68
R5152:Shcbp1	UTSW	8	4736138	missense	probably damaging	1.00
R5540:Shcbp1	UTSW	8	4744529	missense	probably damaging	1.00
R5758:Shcbp1	UTSW	8	4749355	splice site	probably null
R5878:Shcbp1	UTSW	8	4748742	missense	probably benign	0.04
R6062:Shcbp1	UTSW	8	4764905	missense	probably benign	0.13
R6366:Shcbp1	UTSW	8	4749380	missense	probably damaging	1.00
R6394:Shcbp1	UTSW	8	4736176	missense	probably damaging	0.99
R6513:Shcbp1	UTSW	8	4744507	missense	probably benign
R6696:Shcbp1	UTSW	8	4739262	missense	probably damaging	1.00
R7014:Shcbp1	UTSW	8	4754234	missense	probably damaging	1.00
R7334:Shcbp1	UTSW	8	4741876	missense	probably damaging	1.00
R7334:Shcbp1	UTSW	8	4754310	missense	probably damaging	1.00
R7420:Shcbp1	UTSW	8	4748737	missense	probably benign	0.02
R7710:Shcbp1	UTSW	8	4764965	missense	probably benign	0.14
R7756:Shcbp1	UTSW	8	4744545	missense	probably damaging	0.97
R7769:Shcbp1	UTSW	8	4739232	missense	probably damaging	1.00
R7943:Shcbp1	UTSW	8	4748812	missense	possibly damaging	0.78
R8114:Shcbp1	UTSW	8	4767930	missense	probably damaging	1.00
R8386:Shcbp1	UTSW	8	4767951	missense	probably damaging	1.00
R8435:Shcbp1	UTSW	8	4748734	missense	probably benign	0.04
R9234:Shcbp1	UTSW	8	4748800	missense	possibly damaging	0.77
R9313:Shcbp1	UTSW	8	4744518	missense	probably damaging	1.00
X0062:Shcbp1	UTSW	8	4739249	missense	probably damaging	0.99
Z1176:Shcbp1	UTSW	8	4765056	missense	possibly damaging	0.59
Z1177:Shcbp1	UTSW	8	4736146	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGGATCAAAGGTTCGACAC -3'
(R):5'- GTGACAAGCACACAACTGAG -3'

Sequencing Primer
(F):5'- TCAAAGGTTCGACACTTATAGGG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'

Posted On

2019-11-12