Mutagenetix > Incidental Mutation

Incidental Mutation 'R7720:Gria4'

595177

Institutional Source

Beutler Lab

Gene Symbol

Gria4

Ensembl Gene

ENSMUSG00000025892

Gene Name

glutamate receptor, ionotropic, AMPA4 (alpha 4)

Synonyms

Gluralpha4, spkw1, Glur4, Glur-4

MMRRC Submission

067892-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.738) question?

Stock #

R7720 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4417896-4796234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 4464288 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 558 (V558D)

Ref Sequence

ENSEMBL: ENSMUSP00000066980 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]

AlphaFold

Q9Z2W8

Predicted Effect

probably damaging
Transcript: ENSMUST00000027020
AA Change: V558D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: V558D

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3e-61	PFAM
PBPe	416	791	8.23e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000063508
AA Change: V558D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: V558D

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	2.5e-71	PFAM
PBPe	416	791	2.06e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000212533
AA Change: V558D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	T	A	16: 8,843,102	C148S	probably damaging	Het
4921530L21Rik	A	G	14: 95,882,112	R102G	probably benign	Het
A230050P20Rik	C	T	9: 20,868,859		probably benign	Het
Agap2	A	G	10: 127,091,088	D1018G	probably damaging	Het
Atm	T	C	9: 53,522,239	N237S	possibly damaging	Het
Card6	G	T	15: 5,098,423	Q1164K	unknown	Het
Cped1	G	A	6: 22,222,431	C730Y	probably damaging	Het
Csmd1	A	T	8: 15,931,108	L2770Q	probably damaging	Het
Ctsw	T	C	19: 5,467,044	T87A	probably damaging	Het
Dock4	T	C	12: 40,806,975	I1269T	probably damaging	Het
F11	T	C	8: 45,252,090	E138G	possibly damaging	Het
Fam124b	A	G	1: 80,200,257	S342P	probably damaging	Het
Fam71d	T	C	12: 78,712,133	S76P	probably damaging	Het
Gipr	T	C	7: 19,162,959	I129V	probably benign	Het
Gm5415	T	C	1: 32,546,097	D244G	probably benign	Het
Gsdme	C	T	6: 50,229,308	G185E	probably damaging	Het
Hgd	T	A	16: 37,593,435	D86E	probably benign	Het
Hmcn1	T	A	1: 150,646,709	H3480L	probably benign	Het
Hs2st1	T	C	3: 144,454,022	N127D	probably damaging	Het
Ilf3	A	G	9: 21,399,537	N599S	possibly damaging	Het
Itsn1	G	A	16: 91,868,083	G1132R	unknown	Het
Jakmip2	A	G	18: 43,571,908	S343P	possibly damaging	Het
Kif1b	A	G	4: 149,182,355	V1670A	probably benign	Het
Lman2	A	T	13: 55,353,077		probably null	Het
Ltbp1	A	T	17: 75,385,124	Y1579F	probably damaging	Het
Mon2	G	A	10: 123,032,588	A520V	probably benign	Het
Mrpl10	T	G	11: 97,047,537	V171G	possibly damaging	Het
Mrps27	A	T	13: 99,401,330	T153S	unknown	Het
Muc5ac	G	C	7: 141,809,303	G2117A	unknown	Het
Nlrp10	A	G	7: 108,924,488	V595A	probably benign	Het
Nol4	A	T	18: 23,040,023	M7K	probably benign	Het
Oasl1	G	A	5: 114,929,921	S188N	probably damaging	Het
Olfr193	T	C	16: 59,109,771	I280V	probably benign	Het
Olfr709-ps1	C	A	7: 106,927,411	G16V	probably benign	Het
Pcdhga2	A	G	18: 37,669,940	Y279C	probably damaging	Het
Pfpl	C	T	19: 12,429,174	A263V	probably benign	Het
Phf3	T	G	1: 30,829,857	K703N	probably damaging	Het
Pik3ca	C	G	3: 32,436,218	P5A	probably damaging	Het
Plekha6	T	C	1: 133,293,707	V987A	probably damaging	Het
Ppp3ca	T	A	3: 136,890,489	I305N	probably damaging	Het
Prex2	A	G	1: 11,181,937	K1069E	possibly damaging	Het
Prss50	T	C	9: 110,861,335	V182A	probably damaging	Het
Ptprg	A	G	14: 12,211,703	N995S	probably benign	Het
Robo2	C	A	16: 73,897,015	G1375V	probably benign	Het
Rtl1	T	C	12: 109,594,430	Y325C	possibly damaging	Het
Shcbp1	A	C	8: 4,748,720	S400A	probably damaging	Het
Sirpb1c	T	A	3: 15,832,072	Y380F	probably benign	Het
Tbl2	G	C	5: 135,159,475	L374F	probably damaging	Het
Tpr	C	A	1: 150,429,532	A1524E	possibly damaging	Het
Vmn2r45	T	A	7: 8,483,461	E276V	probably damaging	Het
Vps16	C	T	2: 130,441,703	Q606*	probably null	Het
Vstm5	A	T	9: 15,239,356	Q29L	probably benign	Het
Wipi1	G	T	11: 109,582,423	S250Y	probably damaging	Het

Other mutations in Gria4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Gria4	APN	9	4472202	missense	probably damaging	0.98
IGL01451:Gria4	APN	9	4503652	missense	probably benign	0.04
IGL01533:Gria4	APN	9	4502395	missense	probably damaging	1.00
IGL01994:Gria4	APN	9	4537726	missense	probably damaging	1.00
IGL02078:Gria4	APN	9	4793878	missense	probably damaging	0.98
IGL02183:Gria4	APN	9	4502460	missense	probably damaging	1.00
IGL02351:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL02358:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL03118:Gria4	APN	9	4793804	splice site	probably benign
IGL03131:Gria4	APN	9	4432876	missense	probably damaging	0.96
IGL03148:Gria4	APN	9	4464295	missense	possibly damaging	0.91
IGL03264:Gria4	APN	9	4513288	missense	probably benign
PIT4812001:Gria4	UTSW	9	4427128	missense	probably damaging	1.00
R0018:Gria4	UTSW	9	4432843	missense	possibly damaging	0.71
R0295:Gria4	UTSW	9	4793840	missense	possibly damaging	0.69
R0654:Gria4	UTSW	9	4464372	missense	probably benign	0.32
R0690:Gria4	UTSW	9	4427071	missense	probably damaging	1.00
R0992:Gria4	UTSW	9	4795238	missense	probably benign
R1517:Gria4	UTSW	9	4793865	missense	probably damaging	1.00
R1673:Gria4	UTSW	9	4537637	nonsense	probably null
R1713:Gria4	UTSW	9	4424448	missense	probably benign	0.20
R1961:Gria4	UTSW	9	4519546	splice site	probably benign
R2137:Gria4	UTSW	9	4427026	intron	probably benign
R2397:Gria4	UTSW	9	4537717	missense	probably damaging	1.00
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R3014:Gria4	UTSW	9	4464294	missense	probably damaging	0.97
R3412:Gria4	UTSW	9	4513278	missense	probably benign	0.00
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3733:Gria4	UTSW	9	4513295	missense	probably benign
R3897:Gria4	UTSW	9	4513260	missense	probably damaging	1.00
R4404:Gria4	UTSW	9	4464489	splice site	probably null
R4457:Gria4	UTSW	9	4427074	missense	probably damaging	1.00
R4672:Gria4	UTSW	9	4664981	missense	possibly damaging	0.96
R4865:Gria4	UTSW	9	4464295	missense	possibly damaging	0.91
R5092:Gria4	UTSW	9	4472176	missense	probably benign	0.01
R5109:Gria4	UTSW	9	4472168	missense	probably damaging	1.00
R5202:Gria4	UTSW	9	4424330	missense	probably benign	0.10
R5828:Gria4	UTSW	9	4432832	missense	probably damaging	1.00
R5945:Gria4	UTSW	9	4456122	missense	probably damaging	1.00
R5985:Gria4	UTSW	9	4503593	missense	probably damaging	0.99
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6111:Gria4	UTSW	9	4502430	missense	probably damaging	1.00
R6190:Gria4	UTSW	9	4420199	missense	probably benign
R6280:Gria4	UTSW	9	4456072	missense	probably damaging	1.00
R6406:Gria4	UTSW	9	4427077	missense	probably damaging	1.00
R6470:Gria4	UTSW	9	4503680	missense	probably damaging	1.00
R6485:Gria4	UTSW	9	4464249	missense	probably damaging	1.00
R6612:Gria4	UTSW	9	4472206	missense	possibly damaging	0.93
R6848:Gria4	UTSW	9	4793822	missense	probably damaging	1.00
R7046:Gria4	UTSW	9	4420278	missense	probably damaging	0.97
R7210:Gria4	UTSW	9	4464135	missense	probably damaging	1.00
R7284:Gria4	UTSW	9	4472017	missense	probably damaging	1.00
R7475:Gria4	UTSW	9	4513330	missense	probably damaging	1.00
R7501:Gria4	UTSW	9	4502436	missense	probably benign	0.01
R7536:Gria4	UTSW	9	4464298	missense	probably damaging	1.00
R7604:Gria4	UTSW	9	4464315	missense	probably damaging	1.00
R7643:Gria4	UTSW	9	4793950	missense	probably benign	0.00
R7669:Gria4	UTSW	9	4462029	missense	probably damaging	1.00
R7703:Gria4	UTSW	9	4503588	missense	probably benign
R7724:Gria4	UTSW	9	4472074	missense	probably damaging	1.00
R7909:Gria4	UTSW	9	4464450	missense	probably damaging	1.00
R8007:Gria4	UTSW	9	4503740	splice site	probably benign
R8044:Gria4	UTSW	9	4456216	missense	probably damaging	1.00
R8062:Gria4	UTSW	9	4480273	missense	possibly damaging	0.54
R8131:Gria4	UTSW	9	4502429	missense	probably benign	0.16
R8212:Gria4	UTSW	9	4480242	missense	probably benign
R8478:Gria4	UTSW	9	4793882	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424347	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424351	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4456106	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4795189	missense	possibly damaging	0.92
R8888:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R8895:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R9160:Gria4	UTSW	9	4424412	missense	probably damaging	1.00
R9498:Gria4	UTSW	9	4503560	critical splice donor site	probably null
R9743:Gria4	UTSW	9	4464457	missense	probably damaging	1.00
X0023:Gria4	UTSW	9	4427067	missense	probably damaging	1.00
X0065:Gria4	UTSW	9	4464340	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TTTTGACTCCAGGAAAGGAAGATACAG -3'
(R):5'- CAATCACGTTGGTGCGAGAG -3'

Sequencing Primer
(F):5'- TGATACTAACCTGGGTGAAATGTC -3'
(R):5'- AGGAGGTCATCGACTTTTCTAAGCC -3'

Posted On

2019-11-12