Incidental Mutation 'R7720:Gria4'
ID 595177
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Name glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms Glur-4, spkw1, Gluralpha4, Glur4
MMRRC Submission 067892-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.690) question?
Stock # R7720 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 4417896-4796234 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4464288 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 558 (V558D)
Ref Sequence ENSEMBL: ENSMUSP00000066980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]
AlphaFold Q9Z2W8
Predicted Effect probably damaging
Transcript: ENSMUST00000027020
AA Change: V558D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: V558D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000063508
AA Change: V558D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: V558D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212533
AA Change: V558D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 126,926,957 (GRCm39) D1018G probably damaging Het
Atm T C 9: 53,433,539 (GRCm39) N237S possibly damaging Het
Card6 G T 15: 5,127,905 (GRCm39) Q1164K unknown Het
Ccdc202 A G 14: 96,119,548 (GRCm39) R102G probably benign Het
Cped1 G A 6: 22,222,430 (GRCm39) C730Y probably damaging Het
Csmd1 A T 8: 15,981,108 (GRCm39) L2770Q probably damaging Het
Ctsw T C 19: 5,517,072 (GRCm39) T87A probably damaging Het
Dock4 T C 12: 40,856,974 (GRCm39) I1269T probably damaging Het
F11 T C 8: 45,705,127 (GRCm39) E138G possibly damaging Het
Fam124b A G 1: 80,177,974 (GRCm39) S342P probably damaging Het
Garin2 T C 12: 78,758,907 (GRCm39) S76P probably damaging Het
Gipr T C 7: 18,896,884 (GRCm39) I129V probably benign Het
Gsdme C T 6: 50,206,288 (GRCm39) G185E probably damaging Het
Hapstr1 T A 16: 8,660,966 (GRCm39) C148S probably damaging Het
Hgd T A 16: 37,413,797 (GRCm39) D86E probably benign Het
Hmcn1 T A 1: 150,522,460 (GRCm39) H3480L probably benign Het
Hs2st1 T C 3: 144,159,783 (GRCm39) N127D probably damaging Het
Ilf3 A G 9: 21,310,833 (GRCm39) N599S possibly damaging Het
Itsn1 G A 16: 91,664,971 (GRCm39) G1132R unknown Het
Jakmip2 A G 18: 43,704,973 (GRCm39) S343P possibly damaging Het
Kif1b A G 4: 149,266,812 (GRCm39) V1670A probably benign Het
Lman2 A T 13: 55,500,890 (GRCm39) probably null Het
Ltbp1 A T 17: 75,692,119 (GRCm39) Y1579F probably damaging Het
Mon2 G A 10: 122,868,493 (GRCm39) A520V probably benign Het
Mrpl10 T G 11: 96,938,363 (GRCm39) V171G possibly damaging Het
Mrps27 A T 13: 99,537,838 (GRCm39) T153S unknown Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Nlrp10 A G 7: 108,523,695 (GRCm39) V595A probably benign Het
Nol4 A T 18: 23,173,080 (GRCm39) M7K probably benign Het
Oasl1 G A 5: 115,067,980 (GRCm39) S188N probably damaging Het
Or2d3c C A 7: 106,526,618 (GRCm39) G16V probably benign Het
Or5h25 T C 16: 58,930,134 (GRCm39) I280V probably benign Het
Pcdhga2 A G 18: 37,802,993 (GRCm39) Y279C probably damaging Het
Pfpl C T 19: 12,406,538 (GRCm39) A263V probably benign Het
Phf3 T G 1: 30,868,938 (GRCm39) K703N probably damaging Het
Pik3ca C G 3: 32,490,367 (GRCm39) P5A probably damaging Het
Plekha6 T C 1: 133,221,445 (GRCm39) V987A probably damaging Het
Ppp3ca T A 3: 136,596,250 (GRCm39) I305N probably damaging Het
Prex2 A G 1: 11,252,161 (GRCm39) K1069E possibly damaging Het
Prss50 T C 9: 110,690,403 (GRCm39) V182A probably damaging Het
Ptprg A G 14: 12,211,703 (GRCm38) N995S probably benign Het
Robo2 C A 16: 73,693,903 (GRCm39) G1375V probably benign Het
Rtl1 T C 12: 109,560,864 (GRCm39) Y325C possibly damaging Het
Semp2l1 T C 1: 32,585,178 (GRCm39) D244G probably benign Het
Shcbp1 A C 8: 4,798,720 (GRCm39) S400A probably damaging Het
Shfl C T 9: 20,780,155 (GRCm39) probably benign Het
Sirpb1c T A 3: 15,886,236 (GRCm39) Y380F probably benign Het
Tbl2 G C 5: 135,188,329 (GRCm39) L374F probably damaging Het
Tpr C A 1: 150,305,283 (GRCm39) A1524E possibly damaging Het
Vmn2r45 T A 7: 8,486,460 (GRCm39) E276V probably damaging Het
Vps16 C T 2: 130,283,623 (GRCm39) Q606* probably null Het
Vstm5 A T 9: 15,150,652 (GRCm39) Q29L probably benign Het
Wipi1 G T 11: 109,473,249 (GRCm39) S250Y probably damaging Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4,472,202 (GRCm39) missense probably damaging 0.98
IGL01451:Gria4 APN 9 4,503,652 (GRCm39) missense probably benign 0.04
IGL01533:Gria4 APN 9 4,502,395 (GRCm39) missense probably damaging 1.00
IGL01994:Gria4 APN 9 4,537,726 (GRCm39) missense probably damaging 1.00
IGL02078:Gria4 APN 9 4,793,878 (GRCm39) missense probably damaging 0.98
IGL02183:Gria4 APN 9 4,502,460 (GRCm39) missense probably damaging 1.00
IGL02351:Gria4 APN 9 4,456,206 (GRCm39) missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4,456,206 (GRCm39) missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4,793,804 (GRCm39) splice site probably benign
IGL03131:Gria4 APN 9 4,432,876 (GRCm39) missense probably damaging 0.96
IGL03148:Gria4 APN 9 4,464,295 (GRCm39) missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4,513,288 (GRCm39) missense probably benign
PIT4812001:Gria4 UTSW 9 4,427,128 (GRCm39) missense probably damaging 1.00
R0018:Gria4 UTSW 9 4,432,843 (GRCm39) missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4,793,840 (GRCm39) missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4,464,372 (GRCm39) missense probably benign 0.32
R0690:Gria4 UTSW 9 4,427,071 (GRCm39) missense probably damaging 1.00
R0992:Gria4 UTSW 9 4,795,238 (GRCm39) missense probably benign
R1517:Gria4 UTSW 9 4,793,865 (GRCm39) missense probably damaging 1.00
R1673:Gria4 UTSW 9 4,537,637 (GRCm39) nonsense probably null
R1713:Gria4 UTSW 9 4,424,448 (GRCm39) missense probably benign 0.20
R1961:Gria4 UTSW 9 4,519,546 (GRCm39) splice site probably benign
R2137:Gria4 UTSW 9 4,427,026 (GRCm39) intron probably benign
R2397:Gria4 UTSW 9 4,537,717 (GRCm39) missense probably damaging 1.00
R2870:Gria4 UTSW 9 4,503,614 (GRCm39) missense probably damaging 0.96
R2870:Gria4 UTSW 9 4,503,614 (GRCm39) missense probably damaging 0.96
R3014:Gria4 UTSW 9 4,464,294 (GRCm39) missense probably damaging 0.97
R3412:Gria4 UTSW 9 4,513,278 (GRCm39) missense probably benign 0.00
R3732:Gria4 UTSW 9 4,513,295 (GRCm39) missense probably benign
R3732:Gria4 UTSW 9 4,513,295 (GRCm39) missense probably benign
R3733:Gria4 UTSW 9 4,513,295 (GRCm39) missense probably benign
R3897:Gria4 UTSW 9 4,513,260 (GRCm39) missense probably damaging 1.00
R4404:Gria4 UTSW 9 4,464,489 (GRCm39) splice site probably null
R4457:Gria4 UTSW 9 4,427,074 (GRCm39) missense probably damaging 1.00
R4672:Gria4 UTSW 9 4,664,981 (GRCm39) missense possibly damaging 0.96
R4865:Gria4 UTSW 9 4,464,295 (GRCm39) missense possibly damaging 0.91
R5092:Gria4 UTSW 9 4,472,176 (GRCm39) missense probably benign 0.01
R5109:Gria4 UTSW 9 4,472,168 (GRCm39) missense probably damaging 1.00
R5202:Gria4 UTSW 9 4,424,330 (GRCm39) missense probably benign 0.10
R5828:Gria4 UTSW 9 4,432,832 (GRCm39) missense probably damaging 1.00
R5945:Gria4 UTSW 9 4,456,122 (GRCm39) missense probably damaging 1.00
R5985:Gria4 UTSW 9 4,503,593 (GRCm39) missense probably damaging 0.99
R6036:Gria4 UTSW 9 4,537,646 (GRCm39) missense probably benign 0.00
R6036:Gria4 UTSW 9 4,537,646 (GRCm39) missense probably benign 0.00
R6111:Gria4 UTSW 9 4,502,430 (GRCm39) missense probably damaging 1.00
R6190:Gria4 UTSW 9 4,420,199 (GRCm39) missense probably benign
R6280:Gria4 UTSW 9 4,456,072 (GRCm39) missense probably damaging 1.00
R6406:Gria4 UTSW 9 4,427,077 (GRCm39) missense probably damaging 1.00
R6470:Gria4 UTSW 9 4,503,680 (GRCm39) missense probably damaging 1.00
R6485:Gria4 UTSW 9 4,464,249 (GRCm39) missense probably damaging 1.00
R6612:Gria4 UTSW 9 4,472,206 (GRCm39) missense possibly damaging 0.93
R6848:Gria4 UTSW 9 4,793,822 (GRCm39) missense probably damaging 1.00
R7046:Gria4 UTSW 9 4,420,278 (GRCm39) missense probably damaging 0.97
R7210:Gria4 UTSW 9 4,464,135 (GRCm39) missense probably damaging 1.00
R7284:Gria4 UTSW 9 4,472,017 (GRCm39) missense probably damaging 1.00
R7475:Gria4 UTSW 9 4,513,330 (GRCm39) missense probably damaging 1.00
R7501:Gria4 UTSW 9 4,502,436 (GRCm39) missense probably benign 0.01
R7536:Gria4 UTSW 9 4,464,298 (GRCm39) missense probably damaging 1.00
R7604:Gria4 UTSW 9 4,464,315 (GRCm39) missense probably damaging 1.00
R7643:Gria4 UTSW 9 4,793,950 (GRCm39) missense probably benign 0.00
R7669:Gria4 UTSW 9 4,462,029 (GRCm39) missense probably damaging 1.00
R7703:Gria4 UTSW 9 4,503,588 (GRCm39) missense probably benign
R7724:Gria4 UTSW 9 4,472,074 (GRCm39) missense probably damaging 1.00
R7909:Gria4 UTSW 9 4,464,450 (GRCm39) missense probably damaging 1.00
R8007:Gria4 UTSW 9 4,503,740 (GRCm39) splice site probably benign
R8044:Gria4 UTSW 9 4,456,216 (GRCm39) missense probably damaging 1.00
R8062:Gria4 UTSW 9 4,480,273 (GRCm39) missense possibly damaging 0.54
R8131:Gria4 UTSW 9 4,502,429 (GRCm39) missense probably benign 0.16
R8212:Gria4 UTSW 9 4,480,242 (GRCm39) missense probably benign
R8478:Gria4 UTSW 9 4,793,882 (GRCm39) missense probably damaging 1.00
R8699:Gria4 UTSW 9 4,424,351 (GRCm39) missense probably damaging 1.00
R8699:Gria4 UTSW 9 4,424,347 (GRCm39) missense probably damaging 1.00
R8785:Gria4 UTSW 9 4,795,189 (GRCm39) missense possibly damaging 0.92
R8785:Gria4 UTSW 9 4,456,106 (GRCm39) missense probably damaging 1.00
R8888:Gria4 UTSW 9 4,664,951 (GRCm39) missense probably damaging 1.00
R8895:Gria4 UTSW 9 4,664,951 (GRCm39) missense probably damaging 1.00
R9160:Gria4 UTSW 9 4,424,412 (GRCm39) missense probably damaging 1.00
R9498:Gria4 UTSW 9 4,503,560 (GRCm39) critical splice donor site probably null
R9743:Gria4 UTSW 9 4,464,457 (GRCm39) missense probably damaging 1.00
X0023:Gria4 UTSW 9 4,427,067 (GRCm39) missense probably damaging 1.00
X0065:Gria4 UTSW 9 4,464,340 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTTTGACTCCAGGAAAGGAAGATACAG -3'
(R):5'- CAATCACGTTGGTGCGAGAG -3'

Sequencing Primer
(F):5'- TGATACTAACCTGGGTGAAATGTC -3'
(R):5'- AGGAGGTCATCGACTTTTCTAAGCC -3'
Posted On 2019-11-12