Mutagenetix > Incidental Mutations

Incidental Mutation 'R7720:Atm'

595180

Institutional Source

Beutler Lab

Gene Symbol

Atm

Ensembl Gene

ENSMUSG00000034218

Gene Name

ataxia telangiectasia mutated

Synonyms

C030026E19Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.880) question?

Stock #

R7720 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53439149-53536740 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53522239 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 237 (N237S)

Ref Sequence

ENSEMBL: ENSMUSP00000113388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000150244] [ENSMUST00000232179]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000118282
AA Change: N237S

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: N237S

Domain	Start	End	E-Value	Type
TAN	1	166	5.07e-68	SMART
low complexity region	431	445	N/A	INTRINSIC
low complexity region	830	846	N/A	INTRINSIC
low complexity region	929	940	N/A	INTRINSIC
SCOP:d1gw5a_	1039	1568	2e-4	SMART
coiled coil region	1615	1644	N/A	INTRINSIC
low complexity region	1650	1662	N/A	INTRINSIC
Pfam:FAT	2102	2499	4.4e-50	PFAM
low complexity region	2587	2599	N/A	INTRINSIC
PI3Kc	2723	3026	1.11e-117	SMART
FATC	3034	3066	3.71e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000150244

SMART Domains

Protein: ENSMUSP00000115394
Gene: ENSMUSG00000034218

Domain	Start	End	E-Value	Type
TAN	1	140	2.88e-40	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000232179
AA Change: N237S

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	T	A	16: 8,843,102	C148S	probably damaging	Het
4921530L21Rik	A	G	14: 95,882,112	R102G	probably benign	Het
Agap2	A	G	10: 127,091,088	D1018G	probably damaging	Het
Card6	G	T	15: 5,098,423	Q1164K	unknown	Het
Cped1	G	A	6: 22,222,431	C730Y	probably damaging	Het
Csmd1	A	T	8: 15,931,108	L2770Q	probably damaging	Het
Ctsw	T	C	19: 5,467,044	T87A	probably damaging	Het
Dock4	T	C	12: 40,806,975	I1269T	probably damaging	Het
F11	T	C	8: 45,252,090	E138G	possibly damaging	Het
Fam124b	A	G	1: 80,200,257	S342P	probably damaging	Het
Fam71d	T	C	12: 78,712,133	S76P	probably damaging	Het
Gipr	T	C	7: 19,162,959	I129V	probably benign	Het
Gm5415	T	C	1: 32,546,097	D244G	probably benign	Het
Gria4	A	T	9: 4,464,288	V558D	probably damaging	Het
Gsdme	C	T	6: 50,229,308	G185E	probably damaging	Het
Hgd	T	A	16: 37,593,435	D86E	probably benign	Het
Hmcn1	T	A	1: 150,646,709	H3480L	probably benign	Het
Hs2st1	T	C	3: 144,454,022	N127D	probably damaging	Het
Ifi207	CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG	CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG	1: 173,729,196		probably benign	Het
Ilf3	A	G	9: 21,399,537	N599S	possibly damaging	Het
Itsn1	G	A	16: 91,868,083	G1132R	unknown	Het
Jakmip2	A	G	18: 43,571,908	S343P	possibly damaging	Het
Kif1b	A	G	4: 149,182,355	V1670A	probably benign	Het
Ltbp1	A	T	17: 75,385,124	Y1579F	probably damaging	Het
Mon2	G	A	10: 123,032,588	A520V	probably benign	Het
Mrpl10	T	G	11: 97,047,537	V171G	possibly damaging	Het
Mrps27	A	T	13: 99,401,330	T153S	unknown	Het
Muc5ac	G	C	7: 141,809,303	G2117A	unknown	Het
Nlrp10	A	G	7: 108,924,488	V595A	probably benign	Het
Nol4	A	T	18: 23,040,023	M7K	probably benign	Het
Oasl1	G	A	5: 114,929,921	S188N	probably damaging	Het
Olfr193	T	C	16: 59,109,771	I280V	probably benign	Het
Olfr709-ps1	C	A	7: 106,927,411	G16V	probably benign	Het
Pcdhga2	A	G	18: 37,669,940	Y279C	probably damaging	Het
Pfpl	C	T	19: 12,429,174	A263V	probably benign	Het
Phf3	T	G	1: 30,829,857	K703N	probably damaging	Het
Pik3ca	C	G	3: 32,436,218	P5A	probably damaging	Het
Plekha6	T	C	1: 133,293,707	V987A	probably damaging	Het
Ppp3ca	T	A	3: 136,890,489	I305N	probably damaging	Het
Prex2	A	G	1: 11,181,937	K1069E	possibly damaging	Het
Prss50	T	C	9: 110,861,335	V182A	probably damaging	Het
Ptprg	A	G	14: 12,211,703	N995S	probably benign	Het
Robo2	C	A	16: 73,897,015	G1375V	probably benign	Het
Rtl1	T	C	12: 109,594,430	Y325C	possibly damaging	Het
Shcbp1	A	C	8: 4,748,720	S400A	probably damaging	Het
Sirpb1c	T	A	3: 15,832,072	Y380F	probably benign	Het
Tbl2	G	C	5: 135,159,475	L374F	probably damaging	Het
Tpr	C	A	1: 150,429,532	A1524E	possibly damaging	Het
Vmn2r45	T	A	7: 8,483,461	E276V	probably damaging	Het
Vps16	C	T	2: 130,441,703	Q606*	probably null	Het
Vstm5	A	T	9: 15,239,356	Q29L	probably benign	Het
Wipi1	G	T	11: 109,582,423	S250Y	probably damaging	Het

Other mutations in Atm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Atm	APN	9	53524443	missense	probably damaging	1.00
IGL00466:Atm	APN	9	53499112	splice site	probably benign
IGL00567:Atm	APN	9	53503116	nonsense	probably null
IGL00702:Atm	APN	9	53511831	missense	probably benign	0.02
IGL00743:Atm	APN	9	53513116	missense	probably benign	0.00
IGL00771:Atm	APN	9	53493054	missense	probably benign	0.01
IGL00773:Atm	APN	9	53522144	missense	probably benign	0.00
IGL00819:Atm	APN	9	53518531	missense	probably damaging	1.00
IGL00864:Atm	APN	9	53533933	missense	probably damaging	0.99
IGL00985:Atm	APN	9	53459816	missense	probably damaging	0.98
IGL01109:Atm	APN	9	53490293	missense	probably damaging	1.00
IGL01120:Atm	APN	9	53461122	critical splice acceptor site	probably null
IGL01369:Atm	APN	9	53515317	missense	probably benign
IGL01374:Atm	APN	9	53531724	missense	possibly damaging	0.58
IGL01406:Atm	APN	9	53439746	makesense	probably null
IGL01409:Atm	APN	9	53499171	missense	probably benign	0.01
IGL01434:Atm	APN	9	53507807	missense	probably benign	0.04
IGL01486:Atm	APN	9	53510213	missense	probably benign
IGL01583:Atm	APN	9	53484247	splice site	probably benign
IGL01861:Atm	APN	9	53494612	missense	probably null	0.89
IGL01865:Atm	APN	9	53461002	missense	probably damaging	1.00
IGL02026:Atm	APN	9	53442417	unclassified	probably null
IGL02072:Atm	APN	9	53459796	missense	probably benign	0.01
IGL02075:Atm	APN	9	53527237	missense	probably damaging	1.00
IGL02127:Atm	APN	9	53487983	missense	probably damaging	1.00
IGL02175:Atm	APN	9	53480665	missense	probably damaging	0.99
IGL02246:Atm	APN	9	53527185	missense	probably benign	0.12
IGL02259:Atm	APN	9	53518494	splice site	probably benign
IGL02351:Atm	APN	9	53522176	missense	probably benign	0.04
IGL02358:Atm	APN	9	53522176	missense	probably benign	0.04
IGL02387:Atm	APN	9	53479766	splice site	probably null
IGL02417:Atm	APN	9	53479695	missense	probably benign	0.00
IGL02422:Atm	APN	9	53500792	missense	probably damaging	1.00
IGL02445:Atm	APN	9	53454330	missense	probably benign	0.00
IGL02492:Atm	APN	9	53455859	missense	probably damaging	0.99
IGL02513:Atm	APN	9	53497262	splice site	probably benign
IGL02633:Atm	APN	9	53448153	missense	probably damaging	1.00
IGL02634:Atm	APN	9	53516563	missense	probably benign	0.00
IGL02948:Atm	APN	9	53453440	splice site	probably benign
IGL02959:Atm	APN	9	53471418	missense	probably damaging	1.00
IGL02965:Atm	APN	9	53453563	missense	probably damaging	1.00
IGL03085:Atm	APN	9	53484171	missense	possibly damaging	0.89
antebellum	UTSW	9	53518559	nonsense	probably null
Civil	UTSW	9	53492268	missense	possibly damaging	0.78
Grant	UTSW	9	53511917	nonsense	probably null
mockingbird	UTSW	9	53516467	nonsense	probably null
mockingbird2	UTSW	9	53488587	missense	probably damaging	1.00
osphere	UTSW	9	53479673	missense	probably damaging	0.99
shiloh	UTSW	9	53465298	missense	probably damaging	1.00
Strato	UTSW	9	53503018	missense	probably damaging	1.00
tropo	UTSW	9	53531648	missense	probably damaging	1.00
P0019:Atm	UTSW	9	53465028	splice site	probably benign
PIT4403001:Atm	UTSW	9	53500982	missense	probably benign
PIT4687001:Atm	UTSW	9	53486812	critical splice donor site	probably null
R0004:Atm	UTSW	9	53453528	splice site	probably benign
R0035:Atm	UTSW	9	53513180	missense	probably benign	0.01
R0098:Atm	UTSW	9	53518569	missense	probably benign	0.10
R0098:Atm	UTSW	9	53518569	missense	probably benign	0.10
R0201:Atm	UTSW	9	53454279	splice site	probably benign
R0304:Atm	UTSW	9	53516344	missense	probably benign	0.34
R0308:Atm	UTSW	9	53454473	intron	probably null
R0362:Atm	UTSW	9	53458838	missense	possibly damaging	0.90
R0470:Atm	UTSW	9	53460966	missense	probably damaging	1.00
R0513:Atm	UTSW	9	53503948	missense	probably benign	0.00
R0589:Atm	UTSW	9	53490192	missense	possibly damaging	0.51
R0617:Atm	UTSW	9	53458941	nonsense	probably null
R0630:Atm	UTSW	9	53531622	splice site	probably benign
R0652:Atm	UTSW	9	53486014	missense	probably damaging	0.98
R0698:Atm	UTSW	9	53515239	missense	probably damaging	1.00
R0737:Atm	UTSW	9	53456566	missense	probably damaging	1.00
R0885:Atm	UTSW	9	53459823	missense	probably benign
R0947:Atm	UTSW	9	53504092	missense	probably benign	0.01
R0948:Atm	UTSW	9	53495958	missense	probably benign
R1144:Atm	UTSW	9	53511698	splice site	probably benign
R1252:Atm	UTSW	9	53455840	missense	probably damaging	1.00
R1295:Atm	UTSW	9	53456530	missense	probably damaging	1.00
R1296:Atm	UTSW	9	53456530	missense	probably damaging	1.00
R1419:Atm	UTSW	9	53457489	missense	probably benign	0.00
R1477:Atm	UTSW	9	53464273	missense	probably benign	0.00
R1596:Atm	UTSW	9	53453378	missense	probably damaging	1.00
R1630:Atm	UTSW	9	53479673	missense	probably damaging	0.99
R1667:Atm	UTSW	9	53500932	missense	probably damaging	1.00
R1681:Atm	UTSW	9	53522155	missense	possibly damaging	0.94
R1703:Atm	UTSW	9	53500700	missense	probably benign
R1817:Atm	UTSW	9	53492233	splice site	probably benign
R1840:Atm	UTSW	9	53456530	missense	probably damaging	1.00
R1848:Atm	UTSW	9	53468012	missense	probably benign	0.06
R1906:Atm	UTSW	9	53506568	missense	probably damaging	1.00
R1958:Atm	UTSW	9	53471418	missense	probably damaging	1.00
R2108:Atm	UTSW	9	53443997	missense	probably damaging	1.00
R2116:Atm	UTSW	9	53500969	missense	probably benign	0.36
R2134:Atm	UTSW	9	53467964	critical splice donor site	probably null
R2137:Atm	UTSW	9	53453375	missense	probably damaging	1.00
R2291:Atm	UTSW	9	53490909	splice site	probably null
R2348:Atm	UTSW	9	53492268	missense	possibly damaging	0.78
R2483:Atm	UTSW	9	53510266	missense	probably damaging	1.00
R2567:Atm	UTSW	9	53457470	missense	possibly damaging	0.72
R2897:Atm	UTSW	9	53507805	missense	probably damaging	0.99
R2939:Atm	UTSW	9	53494711	missense	probably damaging	1.00
R3008:Atm	UTSW	9	53480750	missense	probably benign	0.00
R3236:Atm	UTSW	9	53479748	missense	probably benign	0.15
R3847:Atm	UTSW	9	53503075	missense	possibly damaging	0.94
R3889:Atm	UTSW	9	53506636	splice site	probably benign
R3919:Atm	UTSW	9	53492278	missense	probably benign	0.00
R4125:Atm	UTSW	9	53450621	missense	probably damaging	1.00
R4222:Atm	UTSW	9	53480669	missense	probably benign
R4395:Atm	UTSW	9	53465227	missense	probably benign	0.09
R4466:Atm	UTSW	9	53448169	nonsense	probably null
R4502:Atm	UTSW	9	53495946	missense	possibly damaging	0.92
R4514:Atm	UTSW	9	53493039	missense	probably damaging	0.99
R4528:Atm	UTSW	9	53500759	missense	probably benign	0.39
R4593:Atm	UTSW	9	53453594	missense	possibly damaging	0.55
R4627:Atm	UTSW	9	53456506	missense	possibly damaging	0.79
R4634:Atm	UTSW	9	53531733	missense	probably benign	0.01
R4665:Atm	UTSW	9	53464229	missense	probably benign	0.00
R4672:Atm	UTSW	9	53522201	missense	probably damaging	0.99
R4741:Atm	UTSW	9	53453607	missense	probably benign	0.10
R4808:Atm	UTSW	9	53445495	missense	probably damaging	0.99
R4959:Atm	UTSW	9	53515301	missense	probably benign
R4996:Atm	UTSW	9	53524507	missense	probably benign	0.09
R5030:Atm	UTSW	9	53520109	nonsense	probably null
R5214:Atm	UTSW	9	53491027	missense	probably benign	0.09
R5260:Atm	UTSW	9	53506611	missense	probably damaging	0.99
R5311:Atm	UTSW	9	53518623	missense	probably benign	0.00
R5394:Atm	UTSW	9	53507777	critical splice donor site	probably null
R5400:Atm	UTSW	9	53503018	missense	probably damaging	1.00
R5436:Atm	UTSW	9	53459804	missense	probably benign	0.00
R5441:Atm	UTSW	9	53516467	nonsense	probably null
R5569:Atm	UTSW	9	53516450	nonsense	probably null
R5856:Atm	UTSW	9	53495955	missense	possibly damaging	0.64
R5891:Atm	UTSW	9	53497159	missense	probably benign
R5910:Atm	UTSW	9	53448080	missense	probably damaging	0.96
R6054:Atm	UTSW	9	53459873	missense	probably damaging	1.00
R6062:Atm	UTSW	9	53488587	missense	probably damaging	1.00
R6092:Atm	UTSW	9	53524414	missense	probably damaging	1.00
R6127:Atm	UTSW	9	53524509	missense	probably damaging	1.00
R6160:Atm	UTSW	9	53490959	missense	probably benign	0.04
R6267:Atm	UTSW	9	53444000	missense	probably damaging	1.00
R6273:Atm	UTSW	9	53487922	missense	probably benign	0.09
R6284:Atm	UTSW	9	53445376	splice site	probably null
R6478:Atm	UTSW	9	53490254	missense	probably damaging	1.00
R6547:Atm	UTSW	9	53440157	missense	probably damaging	1.00
R6549:Atm	UTSW	9	53493177	missense	probably benign	0.00
R6704:Atm	UTSW	9	53458853	missense	probably benign	0.02
R6715:Atm	UTSW	9	53531648	missense	probably damaging	1.00
R6737:Atm	UTSW	9	53486051	missense	probably benign	0.30
R6759:Atm	UTSW	9	53518559	nonsense	probably null
R6766:Atm	UTSW	9	53490282	missense	probably damaging	0.99
R6813:Atm	UTSW	9	53497235	missense	probably benign	0.00
R6852:Atm	UTSW	9	53482430	missense	possibly damaging	0.93
R7064:Atm	UTSW	9	53507881	missense	probably benign	0.02
R7208:Atm	UTSW	9	53512008	intron	probably null
R7211:Atm	UTSW	9	53488560	missense	probably benign	0.01
R7220:Atm	UTSW	9	53511917	nonsense	probably null
R7336:Atm	UTSW	9	53462503	missense	possibly damaging	0.47
R7363:Atm	UTSW	9	53465298	missense	probably damaging	1.00
R7378:Atm	UTSW	9	53453437	critical splice acceptor site	probably null
R7472:Atm	UTSW	9	53448125	missense	possibly damaging	0.81
R7487:Atm	UTSW	9	53524354	missense	probably benign
R7497:Atm	UTSW	9	53511891	missense	probably benign	0.00
R7584:Atm	UTSW	9	53513127	missense	probably damaging	0.99
R7624:Atm	UTSW	9	53454768	missense	probably damaging	0.99
R7653:Atm	UTSW	9	53490302	nonsense	probably null
R7660:Atm	UTSW	9	53445507	missense	probably benign	0.01
R7679:Atm	UTSW	9	53442497	missense	probably damaging	1.00
X0067:Atm	UTSW	9	53479694	missense	probably benign	0.00
Z1088:Atm	UTSW	9	53531687	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCCTTGTGGATGATGGATATAAATC -3'
(R):5'- AGCCCCAAGTGAGAATCAGTG -3'

Sequencing Primer
(F):5'- TGTGGATGATGGATATAAATCTGCAG -3'
(R):5'- TTACACCCAGTTGACCCT -3'

Posted On

2019-11-12