Incidental Mutation 'R7720:Prss50'
ID595181
Institutional Source Beutler Lab
Gene Symbol Prss50
Ensembl Gene ENSMUSG00000048752
Gene Nameprotease, serine 50
SynonymsTsp50
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7720 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location110857967-110864629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110861335 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 182 (V182A)
Ref Sequence ENSEMBL: ENSMUSP00000059668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050958] [ENSMUST00000051097] [ENSMUST00000119427] [ENSMUST00000176403]
Predicted Effect probably benign
Transcript: ENSMUST00000050958
SMART Domains Protein: ENSMUSP00000060148
Gene: ENSMUSG00000049555

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 37 44 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000051097
AA Change: V182A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059668
Gene: ENSMUSG00000048752
AA Change: V182A

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
low complexity region 112 127 N/A INTRINSIC
Tryp_SPc 172 407 2.87e-43 SMART
low complexity region 425 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119427
SMART Domains Protein: ENSMUSP00000112855
Gene: ENSMUSG00000049719

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 40 273 1.62e-60 SMART
transmembrane domain 288 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176403
SMART Domains Protein: ENSMUSP00000135787
Gene: ENSMUSG00000049719

DomainStartEndE-ValueType
Tryp_SPc 43 276 1.62e-60 SMART
transmembrane domain 291 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196027
Meta Mutation Damage Score 0.2381 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,102 C148S probably damaging Het
4921530L21Rik A G 14: 95,882,112 R102G probably benign Het
A230050P20Rik C T 9: 20,868,859 probably benign Het
Agap2 A G 10: 127,091,088 D1018G probably damaging Het
Atm T C 9: 53,522,239 N237S possibly damaging Het
Card6 G T 15: 5,098,423 Q1164K unknown Het
Cped1 G A 6: 22,222,431 C730Y probably damaging Het
Csmd1 A T 8: 15,931,108 L2770Q probably damaging Het
Ctsw T C 19: 5,467,044 T87A probably damaging Het
Dock4 T C 12: 40,806,975 I1269T probably damaging Het
F11 T C 8: 45,252,090 E138G possibly damaging Het
Fam124b A G 1: 80,200,257 S342P probably damaging Het
Fam71d T C 12: 78,712,133 S76P probably damaging Het
Gipr T C 7: 19,162,959 I129V probably benign Het
Gm5415 T C 1: 32,546,097 D244G probably benign Het
Gria4 A T 9: 4,464,288 V558D probably damaging Het
Gsdme C T 6: 50,229,308 G185E probably damaging Het
Hgd T A 16: 37,593,435 D86E probably benign Het
Hmcn1 T A 1: 150,646,709 H3480L probably benign Het
Hs2st1 T C 3: 144,454,022 N127D probably damaging Het
Ilf3 A G 9: 21,399,537 N599S possibly damaging Het
Itsn1 G A 16: 91,868,083 G1132R unknown Het
Jakmip2 A G 18: 43,571,908 S343P possibly damaging Het
Kif1b A G 4: 149,182,355 V1670A probably benign Het
Lman2 A T 13: 55,353,077 probably null Het
Ltbp1 A T 17: 75,385,124 Y1579F probably damaging Het
Mon2 G A 10: 123,032,588 A520V probably benign Het
Mrpl10 T G 11: 97,047,537 V171G possibly damaging Het
Mrps27 A T 13: 99,401,330 T153S unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nlrp10 A G 7: 108,924,488 V595A probably benign Het
Nol4 A T 18: 23,040,023 M7K probably benign Het
Oasl1 G A 5: 114,929,921 S188N probably damaging Het
Olfr193 T C 16: 59,109,771 I280V probably benign Het
Olfr709-ps1 C A 7: 106,927,411 G16V probably benign Het
Pcdhga2 A G 18: 37,669,940 Y279C probably damaging Het
Pfpl C T 19: 12,429,174 A263V probably benign Het
Phf3 T G 1: 30,829,857 K703N probably damaging Het
Pik3ca C G 3: 32,436,218 P5A probably damaging Het
Plekha6 T C 1: 133,293,707 V987A probably damaging Het
Ppp3ca T A 3: 136,890,489 I305N probably damaging Het
Prex2 A G 1: 11,181,937 K1069E possibly damaging Het
Ptprg A G 14: 12,211,703 N995S probably benign Het
Robo2 C A 16: 73,897,015 G1375V probably benign Het
Rtl1 T C 12: 109,594,430 Y325C possibly damaging Het
Shcbp1 A C 8: 4,748,720 S400A probably damaging Het
Sirpb1c T A 3: 15,832,072 Y380F probably benign Het
Tbl2 G C 5: 135,159,475 L374F probably damaging Het
Tpr C A 1: 150,429,532 A1524E possibly damaging Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Vps16 C T 2: 130,441,703 Q606* probably null Het
Vstm5 A T 9: 15,239,356 Q29L probably benign Het
Wipi1 G T 11: 109,582,423 S250Y probably damaging Het
Other mutations in Prss50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Prss50 APN 9 110862406 missense possibly damaging 0.89
IGL01838:Prss50 APN 9 110864492 missense probably benign 0.38
IGL03185:Prss50 APN 9 110858211 missense probably benign
R0347:Prss50 UTSW 9 110862350 missense probably damaging 0.97
R1545:Prss50 UTSW 9 110861268 missense probably damaging 0.99
R1660:Prss50 UTSW 9 110862489 missense possibly damaging 0.61
R1844:Prss50 UTSW 9 110858013 unclassified probably benign
R1969:Prss50 UTSW 9 110862381 missense probably damaging 0.97
R2025:Prss50 UTSW 9 110861260 missense probably benign 0.00
R2090:Prss50 UTSW 9 110862293 missense probably damaging 1.00
R2917:Prss50 UTSW 9 110862545 missense probably null 1.00
R4063:Prss50 UTSW 9 110858412 missense probably benign
R4799:Prss50 UTSW 9 110863796 missense probably damaging 0.99
R5763:Prss50 UTSW 9 110862449 nonsense probably null
R5984:Prss50 UTSW 9 110862386 missense probably damaging 0.97
R6159:Prss50 UTSW 9 110864303 missense probably benign 0.32
R6318:Prss50 UTSW 9 110861299 missense probably damaging 1.00
R7296:Prss50 UTSW 9 110861289 missense probably damaging 1.00
R7323:Prss50 UTSW 9 110863732 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGGATGCTGTCATTCCATAGC -3'
(R):5'- CTTGATGGGTCACCTGGTAGAG -3'

Sequencing Primer
(F):5'- TGCTGTCATTCCATAGCAACACATAG -3'
(R):5'- CTGGTAGAGTGACCGTGACTC -3'
Posted On2019-11-12