Incidental Mutation 'R7720:Wipi1'
ID595185
Institutional Source Beutler Lab
Gene Symbol Wipi1
Ensembl Gene ENSMUSG00000041895
Gene NameWD repeat domain, phosphoinositide interacting 1
Synonyms4930533H01Rik, D11Ertd498e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock #R7720 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location109573331-109611967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 109582423 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 250 (S250Y)
Ref Sequence ENSEMBL: ENSMUSP00000099349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047186] [ENSMUST00000103060] [ENSMUST00000106689]
Predicted Effect probably damaging
Transcript: ENSMUST00000047186
AA Change: S250Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038635
Gene: ENSMUSG00000041895
AA Change: S250Y

DomainStartEndE-ValueType
low complexity region 68 76 N/A INTRINSIC
Blast:WD40 90 125 7e-12 BLAST
WD40 175 215 3.45e-3 SMART
WD40 218 260 4.13e0 SMART
WD40 306 342 4.93e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103060
AA Change: S250Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099349
Gene: ENSMUSG00000041895
AA Change: S250Y

DomainStartEndE-ValueType
low complexity region 68 76 N/A INTRINSIC
Blast:WD40 90 125 6e-12 BLAST
WD40 175 215 3.45e-3 SMART
WD40 218 260 4.13e0 SMART
WD40 306 342 4.93e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106689
AA Change: S250Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102300
Gene: ENSMUSG00000041895
AA Change: S250Y

DomainStartEndE-ValueType
low complexity region 68 76 N/A INTRINSIC
Blast:WD40 90 125 2e-11 BLAST
Blast:WD40 128 172 1e-6 BLAST
WD40 175 215 3.45e-3 SMART
WD40 218 260 4.13e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD40 repeat protein. Members of the WD40 repeat family are key components of many essential biologic functions. They regulate the assembly of multiprotein complexes by presenting a beta-propeller platform for simultaneous and reversible protein-protein interactions. Members of the WIPI subfamily of WD40 repeat proteins have a 7-bladed propeller structure and contain a conserved motif for interaction with phospholipids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,102 C148S probably damaging Het
4921530L21Rik A G 14: 95,882,112 R102G probably benign Het
A230050P20Rik C T 9: 20,868,859 probably benign Het
Agap2 A G 10: 127,091,088 D1018G probably damaging Het
Atm T C 9: 53,522,239 N237S possibly damaging Het
Card6 G T 15: 5,098,423 Q1164K unknown Het
Cped1 G A 6: 22,222,431 C730Y probably damaging Het
Csmd1 A T 8: 15,931,108 L2770Q probably damaging Het
Ctsw T C 19: 5,467,044 T87A probably damaging Het
Dock4 T C 12: 40,806,975 I1269T probably damaging Het
F11 T C 8: 45,252,090 E138G possibly damaging Het
Fam124b A G 1: 80,200,257 S342P probably damaging Het
Fam71d T C 12: 78,712,133 S76P probably damaging Het
Gipr T C 7: 19,162,959 I129V probably benign Het
Gm5415 T C 1: 32,546,097 D244G probably benign Het
Gria4 A T 9: 4,464,288 V558D probably damaging Het
Gsdme C T 6: 50,229,308 G185E probably damaging Het
Hgd T A 16: 37,593,435 D86E probably benign Het
Hmcn1 T A 1: 150,646,709 H3480L probably benign Het
Hs2st1 T C 3: 144,454,022 N127D probably damaging Het
Ilf3 A G 9: 21,399,537 N599S possibly damaging Het
Itsn1 G A 16: 91,868,083 G1132R unknown Het
Jakmip2 A G 18: 43,571,908 S343P possibly damaging Het
Kif1b A G 4: 149,182,355 V1670A probably benign Het
Lman2 A T 13: 55,353,077 probably null Het
Ltbp1 A T 17: 75,385,124 Y1579F probably damaging Het
Mon2 G A 10: 123,032,588 A520V probably benign Het
Mrpl10 T G 11: 97,047,537 V171G possibly damaging Het
Mrps27 A T 13: 99,401,330 T153S unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nlrp10 A G 7: 108,924,488 V595A probably benign Het
Nol4 A T 18: 23,040,023 M7K probably benign Het
Oasl1 G A 5: 114,929,921 S188N probably damaging Het
Olfr193 T C 16: 59,109,771 I280V probably benign Het
Olfr709-ps1 C A 7: 106,927,411 G16V probably benign Het
Pcdhga2 A G 18: 37,669,940 Y279C probably damaging Het
Pfpl C T 19: 12,429,174 A263V probably benign Het
Phf3 T G 1: 30,829,857 K703N probably damaging Het
Pik3ca C G 3: 32,436,218 P5A probably damaging Het
Plekha6 T C 1: 133,293,707 V987A probably damaging Het
Ppp3ca T A 3: 136,890,489 I305N probably damaging Het
Prex2 A G 1: 11,181,937 K1069E possibly damaging Het
Prss50 T C 9: 110,861,335 V182A probably damaging Het
Ptprg A G 14: 12,211,703 N995S probably benign Het
Robo2 C A 16: 73,897,015 G1375V probably benign Het
Rtl1 T C 12: 109,594,430 Y325C possibly damaging Het
Shcbp1 A C 8: 4,748,720 S400A probably damaging Het
Sirpb1c T A 3: 15,832,072 Y380F probably benign Het
Tbl2 G C 5: 135,159,475 L374F probably damaging Het
Tpr C A 1: 150,429,532 A1524E possibly damaging Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Vps16 C T 2: 130,441,703 Q606* probably null Het
Vstm5 A T 9: 15,239,356 Q29L probably benign Het
Other mutations in Wipi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Wipi1 APN 11 109583119 splice site probably benign
IGL02431:Wipi1 APN 11 109603791 missense probably damaging 1.00
R0082:Wipi1 UTSW 11 109578284 unclassified probably benign
R0400:Wipi1 UTSW 11 109577130 missense probably damaging 1.00
R1420:Wipi1 UTSW 11 109578372 missense probably benign 0.34
R2029:Wipi1 UTSW 11 109583190 missense probably damaging 1.00
R2077:Wipi1 UTSW 11 109577664 missense probably benign 0.04
R4324:Wipi1 UTSW 11 109603836 missense possibly damaging 0.63
R4928:Wipi1 UTSW 11 109579649 missense probably benign 0.04
R6964:Wipi1 UTSW 11 109603764 missense probably benign 0.15
R7283:Wipi1 UTSW 11 109611311 start codon destroyed probably null 0.23
R7739:Wipi1 UTSW 11 109579709 missense probably damaging 1.00
Z1177:Wipi1 UTSW 11 109597198 missense probably damaging 1.00
Z1177:Wipi1 UTSW 11 109603801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACGGACTCTACTACACTG -3'
(R):5'- TTGAATCCCTCCCATGTGGC -3'

Sequencing Primer
(F):5'- GGACTCTACTACACTGGCAAC -3'
(R):5'- TCCCATGTGGCTTTTTAAACATG -3'
Posted On2019-11-12