Incidental Mutation 'R7720:Mrps27'
ID595189
Institutional Source Beutler Lab
Gene Symbol Mrps27
Ensembl Gene ENSMUSG00000041632
Gene Namemitochondrial ribosomal protein S27
Synonyms2610028H14Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R7720 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location99344786-99415562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99401330 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 153 (T153S)
Ref Sequence ENSEMBL: ENSMUSP00000156296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052249] [ENSMUST00000224660]
Predicted Effect probably benign
Transcript: ENSMUST00000052249
SMART Domains Protein: ENSMUSP00000062326
Gene: ENSMUSG00000041632

DomainStartEndE-ValueType
Pfam:MRP-S27 1 413 8.3e-156 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000224660
AA Change: T153S
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that may be a functional partner of the death associated protein 3 (DAP3). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,102 C148S probably damaging Het
4921530L21Rik A G 14: 95,882,112 R102G probably benign Het
A230050P20Rik C T 9: 20,868,859 probably benign Het
Agap2 A G 10: 127,091,088 D1018G probably damaging Het
Atm T C 9: 53,522,239 N237S possibly damaging Het
Card6 G T 15: 5,098,423 Q1164K unknown Het
Cped1 G A 6: 22,222,431 C730Y probably damaging Het
Csmd1 A T 8: 15,931,108 L2770Q probably damaging Het
Ctsw T C 19: 5,467,044 T87A probably damaging Het
Dock4 T C 12: 40,806,975 I1269T probably damaging Het
F11 T C 8: 45,252,090 E138G possibly damaging Het
Fam124b A G 1: 80,200,257 S342P probably damaging Het
Fam71d T C 12: 78,712,133 S76P probably damaging Het
Gipr T C 7: 19,162,959 I129V probably benign Het
Gm5415 T C 1: 32,546,097 D244G probably benign Het
Gria4 A T 9: 4,464,288 V558D probably damaging Het
Gsdme C T 6: 50,229,308 G185E probably damaging Het
Hgd T A 16: 37,593,435 D86E probably benign Het
Hmcn1 T A 1: 150,646,709 H3480L probably benign Het
Hs2st1 T C 3: 144,454,022 N127D probably damaging Het
Ilf3 A G 9: 21,399,537 N599S possibly damaging Het
Itsn1 G A 16: 91,868,083 G1132R unknown Het
Jakmip2 A G 18: 43,571,908 S343P possibly damaging Het
Kif1b A G 4: 149,182,355 V1670A probably benign Het
Lman2 A T 13: 55,353,077 probably null Het
Ltbp1 A T 17: 75,385,124 Y1579F probably damaging Het
Mon2 G A 10: 123,032,588 A520V probably benign Het
Mrpl10 T G 11: 97,047,537 V171G possibly damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nlrp10 A G 7: 108,924,488 V595A probably benign Het
Nol4 A T 18: 23,040,023 M7K probably benign Het
Oasl1 G A 5: 114,929,921 S188N probably damaging Het
Olfr193 T C 16: 59,109,771 I280V probably benign Het
Olfr709-ps1 C A 7: 106,927,411 G16V probably benign Het
Pcdhga2 A G 18: 37,669,940 Y279C probably damaging Het
Pfpl C T 19: 12,429,174 A263V probably benign Het
Phf3 T G 1: 30,829,857 K703N probably damaging Het
Pik3ca C G 3: 32,436,218 P5A probably damaging Het
Plekha6 T C 1: 133,293,707 V987A probably damaging Het
Ppp3ca T A 3: 136,890,489 I305N probably damaging Het
Prex2 A G 1: 11,181,937 K1069E possibly damaging Het
Prss50 T C 9: 110,861,335 V182A probably damaging Het
Ptprg A G 14: 12,211,703 N995S probably benign Het
Robo2 C A 16: 73,897,015 G1375V probably benign Het
Rtl1 T C 12: 109,594,430 Y325C possibly damaging Het
Shcbp1 A C 8: 4,748,720 S400A probably damaging Het
Sirpb1c T A 3: 15,832,072 Y380F probably benign Het
Tbl2 G C 5: 135,159,475 L374F probably damaging Het
Tpr C A 1: 150,429,532 A1524E possibly damaging Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Vps16 C T 2: 130,441,703 Q606* probably null Het
Vstm5 A T 9: 15,239,356 Q29L probably benign Het
Wipi1 G T 11: 109,582,423 S250Y probably damaging Het
Other mutations in Mrps27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01666:Mrps27 APN 13 99409816 missense probably damaging 1.00
IGL01685:Mrps27 APN 13 99414920 missense possibly damaging 0.52
P0043:Mrps27 UTSW 13 99412246 missense probably benign
R0122:Mrps27 UTSW 13 99365228 missense probably benign 0.13
R0502:Mrps27 UTSW 13 99409795 splice site probably benign
R0503:Mrps27 UTSW 13 99409795 splice site probably benign
R0611:Mrps27 UTSW 13 99405074 missense probably damaging 1.00
R1540:Mrps27 UTSW 13 99405050 missense probably benign 0.17
R2566:Mrps27 UTSW 13 99400328 nonsense probably null
R4227:Mrps27 UTSW 13 99411340 missense probably damaging 1.00
R4235:Mrps27 UTSW 13 99405041 missense probably damaging 1.00
R4715:Mrps27 UTSW 13 99414815 unclassified probably null
R4761:Mrps27 UTSW 13 99412231 missense probably benign 0.10
R5114:Mrps27 UTSW 13 99411465 unclassified probably benign
R5294:Mrps27 UTSW 13 99409873 missense probably damaging 1.00
R6241:Mrps27 UTSW 13 99412246 missense probably benign
R6387:Mrps27 UTSW 13 99400317 missense possibly damaging 0.80
R6491:Mrps27 UTSW 13 99363030 missense probably damaging 1.00
R6992:Mrps27 UTSW 13 99405014 missense probably benign 0.16
R7165:Mrps27 UTSW 13 99414799 missense possibly damaging 0.89
R7241:Mrps27 UTSW 13 99411280 nonsense probably null
R7709:Mrps27 UTSW 13 99404996 missense probably benign 0.21
Z1177:Mrps27 UTSW 13 99414843 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CCAGACTTTGAAAATCAGAGTTCAGTC -3'
(R):5'- TTGAGACTGCAGCTCTGAGC -3'

Sequencing Primer
(F):5'- TCTCTGTGAAGAATGATTTTCATCTG -3'
(R):5'- ACTGCAGCTCTGAGCCTTGAC -3'
Posted On2019-11-12