Incidental Mutation 'R7720:Card6'
ID595192
Institutional Source Beutler Lab
Gene Symbol Card6
Ensembl Gene ENSMUSG00000041849
Gene Namecaspase recruitment domain family, member 6
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7720 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location5095981-5108539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5098423 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1164 (Q1164K)
Ref Sequence ENSEMBL: ENSMUSP00000112833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118365]
Predicted Effect unknown
Transcript: ENSMUST00000118365
AA Change: Q1164K
SMART Domains Protein: ENSMUSP00000112833
Gene: ENSMUSG00000041849
AA Change: Q1164K

DomainStartEndE-ValueType
CARD 3 89 2.13e-5 SMART
low complexity region 237 245 N/A INTRINSIC
low complexity region 257 273 N/A INTRINSIC
Blast:PGAM 278 656 7e-45 BLAST
low complexity region 919 935 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
internal_repeat_1 962 1041 6.5e-13 PROSPERO
internal_repeat_1 1039 1101 6.5e-13 PROSPERO
low complexity region 1107 1132 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a caspase recruitment domain (CARD), an antiparallel six-helical bundle that mediates homotypic protein-protein interactions. The encoded protein is a microtubule-associated protein that has been shown to interact with receptor-interacting protein kinases and positively modulate signal transduction pathways converging on activation of the inducible transcription factor NF-kB. [provided by RefSeq, Jul 2008]
PHENOTYPE: Knockout mice are viable and grossly normal with no deficits in thymocytes, granulocytes, macrophages, NK cells or T- and B-cell subsets. Various signaling pathways mediating innate and adaptive immune responses appear unaltered. Mice are normally resistant to infection by a wide range of pathogens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,102 C148S probably damaging Het
4921530L21Rik A G 14: 95,882,112 R102G probably benign Het
A230050P20Rik C T 9: 20,868,859 probably benign Het
Agap2 A G 10: 127,091,088 D1018G probably damaging Het
Atm T C 9: 53,522,239 N237S possibly damaging Het
Cped1 G A 6: 22,222,431 C730Y probably damaging Het
Csmd1 A T 8: 15,931,108 L2770Q probably damaging Het
Ctsw T C 19: 5,467,044 T87A probably damaging Het
Dock4 T C 12: 40,806,975 I1269T probably damaging Het
F11 T C 8: 45,252,090 E138G possibly damaging Het
Fam124b A G 1: 80,200,257 S342P probably damaging Het
Fam71d T C 12: 78,712,133 S76P probably damaging Het
Gipr T C 7: 19,162,959 I129V probably benign Het
Gm5415 T C 1: 32,546,097 D244G probably benign Het
Gria4 A T 9: 4,464,288 V558D probably damaging Het
Gsdme C T 6: 50,229,308 G185E probably damaging Het
Hgd T A 16: 37,593,435 D86E probably benign Het
Hmcn1 T A 1: 150,646,709 H3480L probably benign Het
Hs2st1 T C 3: 144,454,022 N127D probably damaging Het
Ilf3 A G 9: 21,399,537 N599S possibly damaging Het
Itsn1 G A 16: 91,868,083 G1132R unknown Het
Jakmip2 A G 18: 43,571,908 S343P possibly damaging Het
Kif1b A G 4: 149,182,355 V1670A probably benign Het
Lman2 A T 13: 55,353,077 probably null Het
Ltbp1 A T 17: 75,385,124 Y1579F probably damaging Het
Mon2 G A 10: 123,032,588 A520V probably benign Het
Mrpl10 T G 11: 97,047,537 V171G possibly damaging Het
Mrps27 A T 13: 99,401,330 T153S unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nlrp10 A G 7: 108,924,488 V595A probably benign Het
Nol4 A T 18: 23,040,023 M7K probably benign Het
Oasl1 G A 5: 114,929,921 S188N probably damaging Het
Olfr193 T C 16: 59,109,771 I280V probably benign Het
Olfr709-ps1 C A 7: 106,927,411 G16V probably benign Het
Pcdhga2 A G 18: 37,669,940 Y279C probably damaging Het
Pfpl C T 19: 12,429,174 A263V probably benign Het
Phf3 T G 1: 30,829,857 K703N probably damaging Het
Pik3ca C G 3: 32,436,218 P5A probably damaging Het
Plekha6 T C 1: 133,293,707 V987A probably damaging Het
Ppp3ca T A 3: 136,890,489 I305N probably damaging Het
Prex2 A G 1: 11,181,937 K1069E possibly damaging Het
Prss50 T C 9: 110,861,335 V182A probably damaging Het
Ptprg A G 14: 12,211,703 N995S probably benign Het
Robo2 C A 16: 73,897,015 G1375V probably benign Het
Rtl1 T C 12: 109,594,430 Y325C possibly damaging Het
Shcbp1 A C 8: 4,748,720 S400A probably damaging Het
Sirpb1c T A 3: 15,832,072 Y380F probably benign Het
Tbl2 G C 5: 135,159,475 L374F probably damaging Het
Tpr C A 1: 150,429,532 A1524E possibly damaging Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Vps16 C T 2: 130,441,703 Q606* probably null Het
Vstm5 A T 9: 15,239,356 Q29L probably benign Het
Wipi1 G T 11: 109,582,423 S250Y probably damaging Het
Other mutations in Card6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Card6 APN 15 5098941 missense possibly damaging 0.93
IGL01307:Card6 APN 15 5100002 missense possibly damaging 0.93
IGL02016:Card6 APN 15 5108256 missense probably damaging 1.00
IGL02976:Card6 APN 15 5099828 nonsense probably null
IGL03328:Card6 APN 15 5105445 splice site probably benign
IGL03356:Card6 APN 15 5100241 missense probably benign 0.00
PIT4131001:Card6 UTSW 15 5108306 missense probably damaging 1.00
PIT4142001:Card6 UTSW 15 5098631 missense unknown
PIT4458001:Card6 UTSW 15 5098691 small deletion probably benign
R0562:Card6 UTSW 15 5105166 missense probably damaging 1.00
R0943:Card6 UTSW 15 5100286 missense probably damaging 1.00
R1654:Card6 UTSW 15 5098732 missense probably benign 0.00
R3892:Card6 UTSW 15 5099296 missense probably benign 0.01
R4408:Card6 UTSW 15 5101054 missense probably damaging 0.97
R4856:Card6 UTSW 15 5105141 synonymous probably null
R4886:Card6 UTSW 15 5105141 synonymous probably null
R4998:Card6 UTSW 15 5100082 missense probably benign 0.00
R5050:Card6 UTSW 15 5100376 missense probably benign 0.00
R5365:Card6 UTSW 15 5105406 missense possibly damaging 0.53
R5518:Card6 UTSW 15 5105214 missense probably damaging 0.99
R5686:Card6 UTSW 15 5100953 missense probably damaging 0.99
R6088:Card6 UTSW 15 5105019 missense possibly damaging 0.56
R6194:Card6 UTSW 15 5098444 missense unknown
R6336:Card6 UTSW 15 5099164 nonsense probably null
R6539:Card6 UTSW 15 5105391 missense probably damaging 0.99
R6560:Card6 UTSW 15 5098885 missense probably damaging 1.00
R7132:Card6 UTSW 15 5098691 small deletion probably benign
R7157:Card6 UTSW 15 5100109 missense probably benign 0.07
R7174:Card6 UTSW 15 5098691 small deletion probably benign
R7186:Card6 UTSW 15 5098691 small deletion probably benign
R7338:Card6 UTSW 15 5099872 missense probably benign 0.09
R7430:Card6 UTSW 15 5099200 missense probably benign 0.00
R7579:Card6 UTSW 15 5098691 small deletion probably benign
R7677:Card6 UTSW 15 5098444 missense unknown
R7718:Card6 UTSW 15 5099787 missense possibly damaging 0.54
R7756:Card6 UTSW 15 5099896 nonsense probably null
R7758:Card6 UTSW 15 5099896 nonsense probably null
R7762:Card6 UTSW 15 5105338 missense probably benign
R7786:Card6 UTSW 15 5098691 small deletion probably benign
R7808:Card6 UTSW 15 5099472 missense probably benign 0.00
R7817:Card6 UTSW 15 5098691 small deletion probably benign
R7822:Card6 UTSW 15 5098865 missense possibly damaging 0.82
R7902:Card6 UTSW 15 5098691 small deletion probably benign
R8048:Card6 UTSW 15 5098691 small deletion probably benign
RF013:Card6 UTSW 15 5100142 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCTGCTATGCACTTAAGACTTTGC -3'
(R):5'- ACAGTCCTCCCATGCTAAGC -3'

Sequencing Primer
(F):5'- TGGGAAGAATAGCTTAAGC -3'
(R):5'- TGCTAAGCCCTCTCATCCACAG -3'
Posted On2019-11-12