Mutagenetix > Incidental Mutations

Incidental Mutation 'R7720:Olfr193'

595195

Institutional Source

Beutler Lab

Gene Symbol

Olfr193

Ensembl Gene

ENSMUSG00000060057

Gene Name

olfactory receptor 193

Synonyms

Olfr1540-ps1, MOR183-7P, GA_x54KRFPKG5P-55338697-55337768, MOR113-7P, MOR113-7P

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R7720 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59107924-59111881 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59109771 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 280 (I280V)

Ref Sequence

ENSEMBL: ENSMUSP00000146393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076262] [ENSMUST00000207935] [ENSMUST00000208455]

Predicted Effect

probably benign
Transcript: ENSMUST00000076262
AA Change: I280V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000075611
Gene: ENSMUSG00000060057
AA Change: I280V

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	2.3e-48	PFAM
Pfam:7tm_1	41	290	5.4e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000207935

Predicted Effect

probably benign
Transcript: ENSMUST00000208455
AA Change: I280V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	T	A	16: 8,843,102	C148S	probably damaging	Het
4921530L21Rik	A	G	14: 95,882,112	R102G	probably benign	Het
A230050P20Rik	C	T	9: 20,868,859		probably benign	Het
Agap2	A	G	10: 127,091,088	D1018G	probably damaging	Het
Atm	T	C	9: 53,522,239	N237S	possibly damaging	Het
Card6	G	T	15: 5,098,423	Q1164K	unknown	Het
Cped1	G	A	6: 22,222,431	C730Y	probably damaging	Het
Csmd1	A	T	8: 15,931,108	L2770Q	probably damaging	Het
Ctsw	T	C	19: 5,467,044	T87A	probably damaging	Het
Dock4	T	C	12: 40,806,975	I1269T	probably damaging	Het
F11	T	C	8: 45,252,090	E138G	possibly damaging	Het
Fam124b	A	G	1: 80,200,257	S342P	probably damaging	Het
Fam71d	T	C	12: 78,712,133	S76P	probably damaging	Het
Gipr	T	C	7: 19,162,959	I129V	probably benign	Het
Gm5415	T	C	1: 32,546,097	D244G	probably benign	Het
Gria4	A	T	9: 4,464,288	V558D	probably damaging	Het
Gsdme	C	T	6: 50,229,308	G185E	probably damaging	Het
Hgd	T	A	16: 37,593,435	D86E	probably benign	Het
Hmcn1	T	A	1: 150,646,709	H3480L	probably benign	Het
Hs2st1	T	C	3: 144,454,022	N127D	probably damaging	Het
Ilf3	A	G	9: 21,399,537	N599S	possibly damaging	Het
Itsn1	G	A	16: 91,868,083	G1132R	unknown	Het
Jakmip2	A	G	18: 43,571,908	S343P	possibly damaging	Het
Kif1b	A	G	4: 149,182,355	V1670A	probably benign	Het
Lman2	A	T	13: 55,353,077		probably null	Het
Ltbp1	A	T	17: 75,385,124	Y1579F	probably damaging	Het
Mon2	G	A	10: 123,032,588	A520V	probably benign	Het
Mrpl10	T	G	11: 97,047,537	V171G	possibly damaging	Het
Mrps27	A	T	13: 99,401,330	T153S	unknown	Het
Muc5ac	G	C	7: 141,809,303	G2117A	unknown	Het
Nlrp10	A	G	7: 108,924,488	V595A	probably benign	Het
Nol4	A	T	18: 23,040,023	M7K	probably benign	Het
Oasl1	G	A	5: 114,929,921	S188N	probably damaging	Het
Olfr709-ps1	C	A	7: 106,927,411	G16V	probably benign	Het
Pcdhga2	A	G	18: 37,669,940	Y279C	probably damaging	Het
Pfpl	C	T	19: 12,429,174	A263V	probably benign	Het
Phf3	T	G	1: 30,829,857	K703N	probably damaging	Het
Pik3ca	C	G	3: 32,436,218	P5A	probably damaging	Het
Plekha6	T	C	1: 133,293,707	V987A	probably damaging	Het
Ppp3ca	T	A	3: 136,890,489	I305N	probably damaging	Het
Prex2	A	G	1: 11,181,937	K1069E	possibly damaging	Het
Prss50	T	C	9: 110,861,335	V182A	probably damaging	Het
Ptprg	A	G	14: 12,211,703	N995S	probably benign	Het
Robo2	C	A	16: 73,897,015	G1375V	probably benign	Het
Rtl1	T	C	12: 109,594,430	Y325C	possibly damaging	Het
Shcbp1	A	C	8: 4,748,720	S400A	probably damaging	Het
Sirpb1c	T	A	3: 15,832,072	Y380F	probably benign	Het
Tbl2	G	C	5: 135,159,475	L374F	probably damaging	Het
Tpr	C	A	1: 150,429,532	A1524E	possibly damaging	Het
Vmn2r45	T	A	7: 8,483,461	E276V	probably damaging	Het
Vps16	C	T	2: 130,441,703	Q606*	probably null	Het
Vstm5	A	T	9: 15,239,356	Q29L	probably benign	Het
Wipi1	G	T	11: 109,582,423	S250Y	probably damaging	Het

Other mutations in Olfr193

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Olfr193	APN	16	59110598	missense	probably benign
IGL01613:Olfr193	APN	16	59109921	missense	probably damaging	1.00
IGL02280:Olfr193	APN	16	59110332	missense	probably damaging	1.00
IGL02533:Olfr193	APN	16	59109684	missense	probably benign
IGL02544:Olfr193	APN	16	59110144	missense	probably damaging	1.00
IGL02576:Olfr193	APN	16	59109771	missense	probably benign
IGL02719:Olfr193	APN	16	59110173	missense	probably benign	0.01
IGL03215:Olfr193	APN	16	59109962	missense	possibly damaging	0.46
IGL03272:Olfr193	APN	16	59110556	missense	probably benign	0.01
PIT4802001:Olfr193	UTSW	16	59110601	missense	probably benign
R0544:Olfr193	UTSW	16	59110225	missense	probably benign	0.03
R0783:Olfr193	UTSW	16	59110169	nonsense	probably null
R1070:Olfr193	UTSW	16	59109819	missense	probably benign	0.08
R1211:Olfr193	UTSW	16	59110160	missense	possibly damaging	0.68
R1662:Olfr193	UTSW	16	59110604	missense	probably benign	0.00
R1754:Olfr193	UTSW	16	59110581	missense	probably benign	0.03
R1765:Olfr193	UTSW	16	59109755	missense	probably damaging	1.00
R1937:Olfr193	UTSW	16	59109794	missense	probably benign	0.11
R2875:Olfr193	UTSW	16	59109802	missense	probably benign	0.01
R2910:Olfr193	UTSW	16	59110181	missense	probably benign	0.00
R2911:Olfr193	UTSW	16	59110181	missense	probably benign	0.00
R5084:Olfr193	UTSW	16	59110073	missense	possibly damaging	0.90
R5700:Olfr193	UTSW	16	59109993	missense	probably damaging	0.99
R7018:Olfr193	UTSW	16	59110607	start codon destroyed	probably null	0.98
R7083:Olfr193	UTSW	16	59110037	missense	probably damaging	1.00
R7572:Olfr193	UTSW	16	59110430	missense	probably damaging	1.00
R8045:Olfr193	UTSW	16	59110039	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GAAAAGAGGATTGCTGTGGTTC -3'
(R):5'- CTGGCTCAATTCAGGTATTCAC -3'

Sequencing Primer
(F):5'- GAATATGCAGGACATTTGACCTCCTC -3'
(R):5'- GGCTCAATTCAGGTATTCACAATTAC -3'

Posted On

2019-11-12