Incidental Mutation 'R7720:Olfr193'
ID595195
Institutional Source Beutler Lab
Gene Symbol Olfr193
Ensembl Gene ENSMUSG00000060057
Gene Nameolfactory receptor 193
SynonymsOlfr1540-ps1, MOR183-7P, GA_x54KRFPKG5P-55338697-55337768, MOR113-7P, MOR113-7P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7720 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location59107924-59111881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59109771 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 280 (I280V)
Ref Sequence ENSEMBL: ENSMUSP00000146393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076262] [ENSMUST00000207935] [ENSMUST00000208455]
Predicted Effect probably benign
Transcript: ENSMUST00000076262
AA Change: I280V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075611
Gene: ENSMUSG00000060057
AA Change: I280V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.3e-48 PFAM
Pfam:7tm_1 41 290 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207935
Predicted Effect probably benign
Transcript: ENSMUST00000208455
AA Change: I280V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,102 C148S probably damaging Het
4921530L21Rik A G 14: 95,882,112 R102G probably benign Het
A230050P20Rik C T 9: 20,868,859 probably benign Het
Agap2 A G 10: 127,091,088 D1018G probably damaging Het
Atm T C 9: 53,522,239 N237S possibly damaging Het
Card6 G T 15: 5,098,423 Q1164K unknown Het
Cped1 G A 6: 22,222,431 C730Y probably damaging Het
Csmd1 A T 8: 15,931,108 L2770Q probably damaging Het
Ctsw T C 19: 5,467,044 T87A probably damaging Het
Dock4 T C 12: 40,806,975 I1269T probably damaging Het
F11 T C 8: 45,252,090 E138G possibly damaging Het
Fam124b A G 1: 80,200,257 S342P probably damaging Het
Fam71d T C 12: 78,712,133 S76P probably damaging Het
Gipr T C 7: 19,162,959 I129V probably benign Het
Gm5415 T C 1: 32,546,097 D244G probably benign Het
Gria4 A T 9: 4,464,288 V558D probably damaging Het
Gsdme C T 6: 50,229,308 G185E probably damaging Het
Hgd T A 16: 37,593,435 D86E probably benign Het
Hmcn1 T A 1: 150,646,709 H3480L probably benign Het
Hs2st1 T C 3: 144,454,022 N127D probably damaging Het
Ilf3 A G 9: 21,399,537 N599S possibly damaging Het
Itsn1 G A 16: 91,868,083 G1132R unknown Het
Jakmip2 A G 18: 43,571,908 S343P possibly damaging Het
Kif1b A G 4: 149,182,355 V1670A probably benign Het
Lman2 A T 13: 55,353,077 probably null Het
Ltbp1 A T 17: 75,385,124 Y1579F probably damaging Het
Mon2 G A 10: 123,032,588 A520V probably benign Het
Mrpl10 T G 11: 97,047,537 V171G possibly damaging Het
Mrps27 A T 13: 99,401,330 T153S unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nlrp10 A G 7: 108,924,488 V595A probably benign Het
Nol4 A T 18: 23,040,023 M7K probably benign Het
Oasl1 G A 5: 114,929,921 S188N probably damaging Het
Olfr709-ps1 C A 7: 106,927,411 G16V probably benign Het
Pcdhga2 A G 18: 37,669,940 Y279C probably damaging Het
Pfpl C T 19: 12,429,174 A263V probably benign Het
Phf3 T G 1: 30,829,857 K703N probably damaging Het
Pik3ca C G 3: 32,436,218 P5A probably damaging Het
Plekha6 T C 1: 133,293,707 V987A probably damaging Het
Ppp3ca T A 3: 136,890,489 I305N probably damaging Het
Prex2 A G 1: 11,181,937 K1069E possibly damaging Het
Prss50 T C 9: 110,861,335 V182A probably damaging Het
Ptprg A G 14: 12,211,703 N995S probably benign Het
Robo2 C A 16: 73,897,015 G1375V probably benign Het
Rtl1 T C 12: 109,594,430 Y325C possibly damaging Het
Shcbp1 A C 8: 4,748,720 S400A probably damaging Het
Sirpb1c T A 3: 15,832,072 Y380F probably benign Het
Tbl2 G C 5: 135,159,475 L374F probably damaging Het
Tpr C A 1: 150,429,532 A1524E possibly damaging Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Vps16 C T 2: 130,441,703 Q606* probably null Het
Vstm5 A T 9: 15,239,356 Q29L probably benign Het
Wipi1 G T 11: 109,582,423 S250Y probably damaging Het
Other mutations in Olfr193
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Olfr193 APN 16 59110598 missense probably benign
IGL01613:Olfr193 APN 16 59109921 missense probably damaging 1.00
IGL02280:Olfr193 APN 16 59110332 missense probably damaging 1.00
IGL02533:Olfr193 APN 16 59109684 missense probably benign
IGL02544:Olfr193 APN 16 59110144 missense probably damaging 1.00
IGL02576:Olfr193 APN 16 59109771 missense probably benign
IGL02719:Olfr193 APN 16 59110173 missense probably benign 0.01
IGL03215:Olfr193 APN 16 59109962 missense possibly damaging 0.46
IGL03272:Olfr193 APN 16 59110556 missense probably benign 0.01
PIT4802001:Olfr193 UTSW 16 59110601 missense probably benign
R0544:Olfr193 UTSW 16 59110225 missense probably benign 0.03
R0783:Olfr193 UTSW 16 59110169 nonsense probably null
R1070:Olfr193 UTSW 16 59109819 missense probably benign 0.08
R1211:Olfr193 UTSW 16 59110160 missense possibly damaging 0.68
R1662:Olfr193 UTSW 16 59110604 missense probably benign 0.00
R1754:Olfr193 UTSW 16 59110581 missense probably benign 0.03
R1765:Olfr193 UTSW 16 59109755 missense probably damaging 1.00
R1937:Olfr193 UTSW 16 59109794 missense probably benign 0.11
R2875:Olfr193 UTSW 16 59109802 missense probably benign 0.01
R2910:Olfr193 UTSW 16 59110181 missense probably benign 0.00
R2911:Olfr193 UTSW 16 59110181 missense probably benign 0.00
R5084:Olfr193 UTSW 16 59110073 missense possibly damaging 0.90
R5700:Olfr193 UTSW 16 59109993 missense probably damaging 0.99
R7018:Olfr193 UTSW 16 59110607 start codon destroyed probably null 0.98
R7083:Olfr193 UTSW 16 59110037 missense probably damaging 1.00
R7572:Olfr193 UTSW 16 59110430 missense probably damaging 1.00
R8045:Olfr193 UTSW 16 59110039 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAAAAGAGGATTGCTGTGGTTC -3'
(R):5'- CTGGCTCAATTCAGGTATTCAC -3'

Sequencing Primer
(F):5'- GAATATGCAGGACATTTGACCTCCTC -3'
(R):5'- GGCTCAATTCAGGTATTCACAATTAC -3'
Posted On2019-11-12