Mutagenetix > Incidental Mutation

Incidental Mutation 'R7720:Robo2'

595196

Institutional Source

Beutler Lab

Gene Symbol

Robo2

Ensembl Gene

ENSMUSG00000052516

Gene Name

roundabout guidance receptor 2

Synonyms

9430089E08Rik, 2600013A04Rik, D230004I22Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Essential gene?

Probably essential (E-score: 0.947) question?

Stock #

R7720 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73891839-74411825 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 73897015 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Valine at position 1375 (G1375V)

Ref Sequence

ENSEMBL: ENSMUSP00000113795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000226478]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000117200
AA Change: G1375V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516
AA Change: G1375V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	43	117	3.56e-9	SMART
IGc2	145	210	3.33e-9	SMART
IGc2	237	300	6.59e-13	SMART
IGc2	326	398	1.3e-11	SMART
IGc2	430	495	3.73e-12	SMART
FN3	522	604	1.42e-15	SMART
FN3	636	721	3.54e-2	SMART
FN3	736	823	6.15e-11	SMART
transmembrane domain	860	882	N/A	INTRINSIC
low complexity region	1040	1065	N/A	INTRINSIC
low complexity region	1072	1083	N/A	INTRINSIC
low complexity region	1191	1199	N/A	INTRINSIC
low complexity region	1210	1234	N/A	INTRINSIC
low complexity region	1318	1342	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000117785

SMART Domains

Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	43	117	3.56e-9	SMART
IGc2	145	210	3.33e-9	SMART
IGc2	237	300	6.59e-13	SMART
IGc2	326	398	1.3e-11	SMART
IGc2	430	495	3.73e-12	SMART
FN3	522	604	1.42e-15	SMART
FN3	636	721	3.54e-2	SMART
FN3	736	823	6.15e-11	SMART
transmembrane domain	860	882	N/A	INTRINSIC
low complexity region	1072	1107	N/A	INTRINSIC
low complexity region	1114	1125	N/A	INTRINSIC
low complexity region	1233	1241	N/A	INTRINSIC
low complexity region	1252	1276	N/A	INTRINSIC
low complexity region	1351	1362	N/A	INTRINSIC
low complexity region	1451	1475	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137420

Predicted Effect

probably null
Transcript: ENSMUST00000226478

Predicted Effect

probably benign
Transcript: ENSMUST00000231426

Predicted Effect

probably null
Transcript: ENSMUST00000231889

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	T	A	16: 8,843,102	C148S	probably damaging	Het
4921530L21Rik	A	G	14: 95,882,112	R102G	probably benign	Het
A230050P20Rik	C	T	9: 20,868,859		probably benign	Het
Agap2	A	G	10: 127,091,088	D1018G	probably damaging	Het
Atm	T	C	9: 53,522,239	N237S	possibly damaging	Het
Card6	G	T	15: 5,098,423	Q1164K	unknown	Het
Cped1	G	A	6: 22,222,431	C730Y	probably damaging	Het
Csmd1	A	T	8: 15,931,108	L2770Q	probably damaging	Het
Ctsw	T	C	19: 5,467,044	T87A	probably damaging	Het
Dock4	T	C	12: 40,806,975	I1269T	probably damaging	Het
F11	T	C	8: 45,252,090	E138G	possibly damaging	Het
Fam124b	A	G	1: 80,200,257	S342P	probably damaging	Het
Fam71d	T	C	12: 78,712,133	S76P	probably damaging	Het
Gipr	T	C	7: 19,162,959	I129V	probably benign	Het
Gm5415	T	C	1: 32,546,097	D244G	probably benign	Het
Gria4	A	T	9: 4,464,288	V558D	probably damaging	Het
Gsdme	C	T	6: 50,229,308	G185E	probably damaging	Het
Hgd	T	A	16: 37,593,435	D86E	probably benign	Het
Hmcn1	T	A	1: 150,646,709	H3480L	probably benign	Het
Hs2st1	T	C	3: 144,454,022	N127D	probably damaging	Het
Ilf3	A	G	9: 21,399,537	N599S	possibly damaging	Het
Itsn1	G	A	16: 91,868,083	G1132R	unknown	Het
Jakmip2	A	G	18: 43,571,908	S343P	possibly damaging	Het
Kif1b	A	G	4: 149,182,355	V1670A	probably benign	Het
Lman2	A	T	13: 55,353,077		probably null	Het
Ltbp1	A	T	17: 75,385,124	Y1579F	probably damaging	Het
Mon2	G	A	10: 123,032,588	A520V	probably benign	Het
Mrpl10	T	G	11: 97,047,537	V171G	possibly damaging	Het
Mrps27	A	T	13: 99,401,330	T153S	unknown	Het
Muc5ac	G	C	7: 141,809,303	G2117A	unknown	Het
Nlrp10	A	G	7: 108,924,488	V595A	probably benign	Het
Nol4	A	T	18: 23,040,023	M7K	probably benign	Het
Oasl1	G	A	5: 114,929,921	S188N	probably damaging	Het
Olfr193	T	C	16: 59,109,771	I280V	probably benign	Het
Olfr709-ps1	C	A	7: 106,927,411	G16V	probably benign	Het
Pcdhga2	A	G	18: 37,669,940	Y279C	probably damaging	Het
Pfpl	C	T	19: 12,429,174	A263V	probably benign	Het
Phf3	T	G	1: 30,829,857	K703N	probably damaging	Het
Pik3ca	C	G	3: 32,436,218	P5A	probably damaging	Het
Plekha6	T	C	1: 133,293,707	V987A	probably damaging	Het
Ppp3ca	T	A	3: 136,890,489	I305N	probably damaging	Het
Prex2	A	G	1: 11,181,937	K1069E	possibly damaging	Het
Prss50	T	C	9: 110,861,335	V182A	probably damaging	Het
Ptprg	A	G	14: 12,211,703	N995S	probably benign	Het
Rtl1	T	C	12: 109,594,430	Y325C	possibly damaging	Het
Shcbp1	A	C	8: 4,748,720	S400A	probably damaging	Het
Sirpb1c	T	A	3: 15,832,072	Y380F	probably benign	Het
Tbl2	G	C	5: 135,159,475	L374F	probably damaging	Het
Tpr	C	A	1: 150,429,532	A1524E	possibly damaging	Het
Vmn2r45	T	A	7: 8,483,461	E276V	probably damaging	Het
Vps16	C	T	2: 130,441,703	Q606*	probably null	Het
Vstm5	A	T	9: 15,239,356	Q29L	probably benign	Het
Wipi1	G	T	11: 109,582,423	S250Y	probably damaging	Het

Other mutations in Robo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Robo2	APN	16	73961700	missense	probably benign
IGL00849:Robo2	APN	16	73973777	missense	possibly damaging	0.80
IGL00908:Robo2	APN	16	73985691	missense	probably damaging	0.98
IGL00944:Robo2	APN	16	73933697	missense	possibly damaging	0.92
IGL00955:Robo2	APN	16	74015972	missense	probably damaging	1.00
IGL00970:Robo2	APN	16	73897046	missense	probably benign	0.00
IGL01020:Robo2	APN	16	73928151	missense	probably benign	0.06
IGL01347:Robo2	APN	16	74352856	missense	probably damaging	1.00
IGL02280:Robo2	APN	16	74046816	missense	probably damaging	1.00
IGL02424:Robo2	APN	16	73973301	missense	possibly damaging	0.89
IGL03376:Robo2	APN	16	73956492	missense	probably damaging	1.00
LCD18:Robo2	UTSW	16	74055954	intron	probably benign
P0018:Robo2	UTSW	16	74046806	missense	possibly damaging	0.82
R0314:Robo2	UTSW	16	73956637	missense	probably damaging	1.00
R0324:Robo2	UTSW	16	73967851	missense	probably damaging	1.00
R0539:Robo2	UTSW	16	73985574	splice site	probably benign
R0620:Robo2	UTSW	16	73967802	missense	possibly damaging	0.92
R0630:Robo2	UTSW	16	73916205	missense	probably benign	0.05
R0701:Robo2	UTSW	16	74046874	missense	probably damaging	1.00
R1155:Robo2	UTSW	16	74035108	missense	probably damaging	1.00
R1168:Robo2	UTSW	16	73948296	missense	probably damaging	1.00
R1195:Robo2	UTSW	16	73916128	splice site	probably null
R1195:Robo2	UTSW	16	73916128	splice site	probably null
R1195:Robo2	UTSW	16	73916128	splice site	probably null
R1317:Robo2	UTSW	16	74035024	missense	probably damaging	1.00
R1422:Robo2	UTSW	16	73978448	missense	probably damaging	0.99
R1452:Robo2	UTSW	16	73961910	missense	probably damaging	1.00
R1649:Robo2	UTSW	16	73899001	missense	probably benign	0.36
R1709:Robo2	UTSW	16	73956523	missense	possibly damaging	0.83
R1751:Robo2	UTSW	16	74035024	missense	probably damaging	1.00
R1761:Robo2	UTSW	16	74035024	missense	probably damaging	1.00
R1885:Robo2	UTSW	16	73916145	missense	probably benign	0.00
R1911:Robo2	UTSW	16	73958325	missense	probably damaging	1.00
R1919:Robo2	UTSW	16	73899154	missense	probably benign
R2005:Robo2	UTSW	16	73933115	missense	possibly damaging	0.82
R2851:Robo2	UTSW	16	73961888	missense	probably damaging	1.00
R3732:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3732:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3733:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3734:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3913:Robo2	UTSW	16	74035005	missense	probably damaging	1.00
R3956:Robo2	UTSW	16	73961867	missense	probably damaging	1.00
R4394:Robo2	UTSW	16	73948379	missense	probably benign	0.13
R4426:Robo2	UTSW	16	73948266	missense	probably damaging	1.00
R4437:Robo2	UTSW	16	73973244	missense	possibly damaging	0.88
R4454:Robo2	UTSW	16	74352519	intron	probably benign
R4478:Robo2	UTSW	16	74015873	missense	probably damaging	1.00
R4586:Robo2	UTSW	16	73961873	missense	probably damaging	0.96
R4621:Robo2	UTSW	16	73985933	missense	probably benign	0.00
R4673:Robo2	UTSW	16	73904378	splice site	probably null
R4798:Robo2	UTSW	16	74352745	missense	probably damaging	1.00
R4812:Robo2	UTSW	16	73916288	missense	probably benign	0.00
R4855:Robo2	UTSW	16	73971191	missense	probably damaging	1.00
R4910:Robo2	UTSW	16	73933778	missense	probably damaging	0.99
R4916:Robo2	UTSW	16	73898915	missense	possibly damaging	0.53
R4948:Robo2	UTSW	16	74352838	missense	possibly damaging	0.88
R5325:Robo2	UTSW	16	73973785	missense	possibly damaging	0.72
R5326:Robo2	UTSW	16	73898965	missense	probably benign	0.20
R5447:Robo2	UTSW	16	73973766	nonsense	probably null
R5542:Robo2	UTSW	16	73898965	missense	probably benign	0.20
R5545:Robo2	UTSW	16	73961747	missense	probably damaging	1.00
R5646:Robo2	UTSW	16	73961819	missense	probably damaging	0.99
R5734:Robo2	UTSW	16	74352784	missense	probably damaging	1.00
R5892:Robo2	UTSW	16	73895780	utr 3 prime	probably benign
R5960:Robo2	UTSW	16	73933715	missense	probably damaging	1.00
R6126:Robo2	UTSW	16	73920682	missense	probably benign	0.00
R6130:Robo2	UTSW	16	73920682	missense	probably benign	0.00
R6153:Robo2	UTSW	16	73920729	missense	probably damaging	1.00
R6240:Robo2	UTSW	16	73982139	missense	probably damaging	1.00
R6247:Robo2	UTSW	16	73967784	missense	probably damaging	1.00
R6304:Robo2	UTSW	16	73958308	missense	probably damaging	1.00
R6337:Robo2	UTSW	16	73928151	missense	probably benign	0.06
R6431:Robo2	UTSW	16	74046809	nonsense	probably null
R6440:Robo2	UTSW	16	73916122	missense	probably benign	0.31
R6596:Robo2	UTSW	16	73971108	missense	probably damaging	1.00
R6919:Robo2	UTSW	16	73961867	missense	probably damaging	1.00
R6927:Robo2	UTSW	16	73982058	missense	probably damaging	1.00
R7029:Robo2	UTSW	16	73948337	missense	probably damaging	1.00
R7078:Robo2	UTSW	16	74352616	missense	probably damaging	1.00
R7092:Robo2	UTSW	16	73956643	missense	probably damaging	0.99
R7136:Robo2	UTSW	16	73956550	missense	probably damaging	0.99
R7192:Robo2	UTSW	16	73920750	missense	probably benign	0.19
R7569:Robo2	UTSW	16	74035115	missense	possibly damaging	0.82
R7686:Robo2	UTSW	16	73958405	missense	probably damaging	1.00
R7772:Robo2	UTSW	16	73961889	missense	probably benign	0.24
R7822:Robo2	UTSW	16	73973171	missense	probably damaging	1.00
R7849:Robo2	UTSW	16	73973244	missense	possibly damaging	0.88
R7881:Robo2	UTSW	16	73920697	missense	probably benign	0.00
R7897:Robo2	UTSW	16	73898950	missense	probably benign
R8135:Robo2	UTSW	16	73933160	missense	probably benign	0.04
R8297:Robo2	UTSW	16	74015926	nonsense	probably null
R8307:Robo2	UTSW	16	73956610	missense	probably damaging	1.00
R8379:Robo2	UTSW	16	73933700	missense	probably damaging	0.99
R8393:Robo2	UTSW	16	73978494	missense	probably damaging	1.00
R8474:Robo2	UTSW	16	73948262	missense	probably damaging	1.00
R8500:Robo2	UTSW	16	73948340	missense	probably damaging	1.00
R8721:Robo2	UTSW	16	73906910	missense
R8734:Robo2	UTSW	16	73967763	splice site	probably benign
R8735:Robo2	UTSW	16	73958359	missense	probably damaging	1.00
R8840:Robo2	UTSW	16	73985682	missense	probably damaging	1.00
R8937:Robo2	UTSW	16	73973261	missense	probably damaging	1.00
R8937:Robo2	UTSW	16	73973262	missense	probably damaging	1.00
R8968:Robo2	UTSW	16	73971053	critical splice donor site	probably null
R9134:Robo2	UTSW	16	73906850	missense
R9622:Robo2	UTSW	16	73933064	missense	probably benign	0.02
R9662:Robo2	UTSW	16	73961678	critical splice donor site	probably null
R9708:Robo2	UTSW	16	73973309	missense	possibly damaging	0.70
R9779:Robo2	UTSW	16	73971077	missense	probably damaging	0.97
X0063:Robo2	UTSW	16	74045828	missense	probably damaging	1.00
Z1176:Robo2	UTSW	16	73933591	missense	probably benign	0.35
Z1177:Robo2	UTSW	16	73940299	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TATAGCGATCCCATCAGCCCAG -3'
(R):5'- TTTCAGAGGAGTCCCTGGTG -3'

Sequencing Primer
(F):5'- GAGACAGGGTTTCTCTATTTGTCCC -3'
(R):5'- AGTCCCTGGTGCCCTACAG -3'

Posted On

2019-11-12