Incidental Mutation 'R7720:Robo2'
ID595196
Institutional Source Beutler Lab
Gene Symbol Robo2
Ensembl Gene ENSMUSG00000052516
Gene Nameroundabout guidance receptor 2
Synonyms9430089E08Rik, 2600013A04Rik, D230004I22Rik
Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R7720 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location73891839-74411825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73897015 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 1375 (G1375V)
Ref Sequence ENSEMBL: ENSMUSP00000113795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000226478]
Predicted Effect probably benign
Transcript: ENSMUST00000117200
AA Change: G1375V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516
AA Change: G1375V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1040 1065 N/A INTRINSIC
low complexity region 1072 1083 N/A INTRINSIC
low complexity region 1191 1199 N/A INTRINSIC
low complexity region 1210 1234 N/A INTRINSIC
low complexity region 1318 1342 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117785
SMART Domains Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1072 1107 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1233 1241 N/A INTRINSIC
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
low complexity region 1451 1475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137420
Predicted Effect probably null
Transcript: ENSMUST00000226478
Predicted Effect probably benign
Transcript: ENSMUST00000231426
Predicted Effect probably null
Transcript: ENSMUST00000231889
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,102 C148S probably damaging Het
4921530L21Rik A G 14: 95,882,112 R102G probably benign Het
A230050P20Rik C T 9: 20,868,859 probably benign Het
Agap2 A G 10: 127,091,088 D1018G probably damaging Het
Atm T C 9: 53,522,239 N237S possibly damaging Het
Card6 G T 15: 5,098,423 Q1164K unknown Het
Cped1 G A 6: 22,222,431 C730Y probably damaging Het
Csmd1 A T 8: 15,931,108 L2770Q probably damaging Het
Ctsw T C 19: 5,467,044 T87A probably damaging Het
Dock4 T C 12: 40,806,975 I1269T probably damaging Het
F11 T C 8: 45,252,090 E138G possibly damaging Het
Fam124b A G 1: 80,200,257 S342P probably damaging Het
Fam71d T C 12: 78,712,133 S76P probably damaging Het
Gipr T C 7: 19,162,959 I129V probably benign Het
Gm5415 T C 1: 32,546,097 D244G probably benign Het
Gria4 A T 9: 4,464,288 V558D probably damaging Het
Gsdme C T 6: 50,229,308 G185E probably damaging Het
Hgd T A 16: 37,593,435 D86E probably benign Het
Hmcn1 T A 1: 150,646,709 H3480L probably benign Het
Hs2st1 T C 3: 144,454,022 N127D probably damaging Het
Ilf3 A G 9: 21,399,537 N599S possibly damaging Het
Itsn1 G A 16: 91,868,083 G1132R unknown Het
Jakmip2 A G 18: 43,571,908 S343P possibly damaging Het
Kif1b A G 4: 149,182,355 V1670A probably benign Het
Lman2 A T 13: 55,353,077 probably null Het
Ltbp1 A T 17: 75,385,124 Y1579F probably damaging Het
Mon2 G A 10: 123,032,588 A520V probably benign Het
Mrpl10 T G 11: 97,047,537 V171G possibly damaging Het
Mrps27 A T 13: 99,401,330 T153S unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nlrp10 A G 7: 108,924,488 V595A probably benign Het
Nol4 A T 18: 23,040,023 M7K probably benign Het
Oasl1 G A 5: 114,929,921 S188N probably damaging Het
Olfr193 T C 16: 59,109,771 I280V probably benign Het
Olfr709-ps1 C A 7: 106,927,411 G16V probably benign Het
Pcdhga2 A G 18: 37,669,940 Y279C probably damaging Het
Pfpl C T 19: 12,429,174 A263V probably benign Het
Phf3 T G 1: 30,829,857 K703N probably damaging Het
Pik3ca C G 3: 32,436,218 P5A probably damaging Het
Plekha6 T C 1: 133,293,707 V987A probably damaging Het
Ppp3ca T A 3: 136,890,489 I305N probably damaging Het
Prex2 A G 1: 11,181,937 K1069E possibly damaging Het
Prss50 T C 9: 110,861,335 V182A probably damaging Het
Ptprg A G 14: 12,211,703 N995S probably benign Het
Rtl1 T C 12: 109,594,430 Y325C possibly damaging Het
Shcbp1 A C 8: 4,748,720 S400A probably damaging Het
Sirpb1c T A 3: 15,832,072 Y380F probably benign Het
Tbl2 G C 5: 135,159,475 L374F probably damaging Het
Tpr C A 1: 150,429,532 A1524E possibly damaging Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Vps16 C T 2: 130,441,703 Q606* probably null Het
Vstm5 A T 9: 15,239,356 Q29L probably benign Het
Wipi1 G T 11: 109,582,423 S250Y probably damaging Het
Other mutations in Robo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Robo2 APN 16 73961700 missense probably benign
IGL00849:Robo2 APN 16 73973777 missense possibly damaging 0.80
IGL00908:Robo2 APN 16 73985691 missense probably damaging 0.98
IGL00944:Robo2 APN 16 73933697 missense possibly damaging 0.92
IGL00955:Robo2 APN 16 74015972 missense probably damaging 1.00
IGL00970:Robo2 APN 16 73897046 missense probably benign 0.00
IGL01020:Robo2 APN 16 73928151 missense probably benign 0.06
IGL01347:Robo2 APN 16 74352856 missense probably damaging 1.00
IGL02280:Robo2 APN 16 74046816 missense probably damaging 1.00
IGL02424:Robo2 APN 16 73973301 missense possibly damaging 0.89
IGL03376:Robo2 APN 16 73956492 missense probably damaging 1.00
LCD18:Robo2 UTSW 16 74055954 intron probably benign
P0018:Robo2 UTSW 16 74046806 missense possibly damaging 0.82
R0314:Robo2 UTSW 16 73956637 missense probably damaging 1.00
R0324:Robo2 UTSW 16 73967851 missense probably damaging 1.00
R0539:Robo2 UTSW 16 73985574 splice site probably benign
R0620:Robo2 UTSW 16 73967802 missense possibly damaging 0.92
R0630:Robo2 UTSW 16 73916205 missense probably benign 0.05
R0701:Robo2 UTSW 16 74046874 missense probably damaging 1.00
R1155:Robo2 UTSW 16 74035108 missense probably damaging 1.00
R1168:Robo2 UTSW 16 73948296 missense probably damaging 1.00
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1317:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1422:Robo2 UTSW 16 73978448 missense probably damaging 0.99
R1452:Robo2 UTSW 16 73961910 missense probably damaging 1.00
R1649:Robo2 UTSW 16 73899001 missense probably benign 0.36
R1709:Robo2 UTSW 16 73956523 missense possibly damaging 0.83
R1751:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1761:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1885:Robo2 UTSW 16 73916145 missense probably benign 0.00
R1911:Robo2 UTSW 16 73958325 missense probably damaging 1.00
R1919:Robo2 UTSW 16 73899154 missense probably benign
R2005:Robo2 UTSW 16 73933115 missense possibly damaging 0.82
R2851:Robo2 UTSW 16 73961888 missense probably damaging 1.00
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3733:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3734:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3913:Robo2 UTSW 16 74035005 missense probably damaging 1.00
R3956:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R4394:Robo2 UTSW 16 73948379 missense probably benign 0.13
R4426:Robo2 UTSW 16 73948266 missense probably damaging 1.00
R4437:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R4454:Robo2 UTSW 16 74352519 intron probably benign
R4478:Robo2 UTSW 16 74015873 missense probably damaging 1.00
R4586:Robo2 UTSW 16 73961873 missense probably damaging 0.96
R4621:Robo2 UTSW 16 73985933 missense probably benign 0.00
R4673:Robo2 UTSW 16 73904378 splice site probably null
R4798:Robo2 UTSW 16 74352745 missense probably damaging 1.00
R4812:Robo2 UTSW 16 73916288 missense probably benign 0.00
R4855:Robo2 UTSW 16 73971191 missense probably damaging 1.00
R4910:Robo2 UTSW 16 73933778 missense probably damaging 0.99
R4916:Robo2 UTSW 16 73898915 missense possibly damaging 0.53
R4948:Robo2 UTSW 16 74352838 missense possibly damaging 0.88
R5325:Robo2 UTSW 16 73973785 missense possibly damaging 0.72
R5326:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5447:Robo2 UTSW 16 73973766 nonsense probably null
R5542:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5545:Robo2 UTSW 16 73961747 missense probably damaging 1.00
R5646:Robo2 UTSW 16 73961819 missense probably damaging 0.99
R5734:Robo2 UTSW 16 74352784 missense probably damaging 1.00
R5892:Robo2 UTSW 16 73895780 utr 3 prime probably benign
R5960:Robo2 UTSW 16 73933715 missense probably damaging 1.00
R6126:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6130:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6153:Robo2 UTSW 16 73920729 missense probably damaging 1.00
R6240:Robo2 UTSW 16 73982139 missense probably damaging 1.00
R6247:Robo2 UTSW 16 73967784 missense probably damaging 1.00
R6304:Robo2 UTSW 16 73958308 missense probably damaging 1.00
R6337:Robo2 UTSW 16 73928151 missense probably benign 0.06
R6431:Robo2 UTSW 16 74046809 nonsense probably null
R6440:Robo2 UTSW 16 73916122 missense probably benign 0.31
R6596:Robo2 UTSW 16 73971108 missense probably damaging 1.00
R6919:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R6927:Robo2 UTSW 16 73982058 missense probably damaging 1.00
R7029:Robo2 UTSW 16 73948337 missense probably damaging 1.00
R7078:Robo2 UTSW 16 74352616 missense probably damaging 1.00
R7092:Robo2 UTSW 16 73956643 missense probably damaging 0.99
R7136:Robo2 UTSW 16 73956550 missense probably damaging 0.99
R7192:Robo2 UTSW 16 73920750 missense probably benign 0.19
R7569:Robo2 UTSW 16 74035115 missense possibly damaging 0.82
R7686:Robo2 UTSW 16 73958405 missense probably damaging 1.00
R7772:Robo2 UTSW 16 73961889 missense probably benign 0.24
R7822:Robo2 UTSW 16 73973171 missense probably damaging 1.00
R7849:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R7881:Robo2 UTSW 16 73920697 missense probably benign 0.00
R7897:Robo2 UTSW 16 73898950 missense probably benign
R7932:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R7964:Robo2 UTSW 16 73920697 missense probably benign 0.00
R7980:Robo2 UTSW 16 73898950 missense probably benign
X0063:Robo2 UTSW 16 74045828 missense probably damaging 1.00
Z1176:Robo2 UTSW 16 73933591 missense probably benign 0.35
Z1177:Robo2 UTSW 16 73940299 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TATAGCGATCCCATCAGCCCAG -3'
(R):5'- TTTCAGAGGAGTCCCTGGTG -3'

Sequencing Primer
(F):5'- GAGACAGGGTTTCTCTATTTGTCCC -3'
(R):5'- AGTCCCTGGTGCCCTACAG -3'
Posted On2019-11-12