Incidental Mutation 'R7720:Itsn1'
ID595197
Institutional Source Beutler Lab
Gene Symbol Itsn1
Ensembl Gene ENSMUSG00000022957
Gene Nameintersectin 1 (SH3 domain protein 1A)
SynonymsIntersectin-L, EHSH1, Eh domain, SH3 domain regulator of endocytosis 1, Ese1, Sh3p17
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7720 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location91729281-91920597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91868083 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 1132 (G1132R)
Ref Sequence ENSEMBL: ENSMUSP00000056011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056482] [ENSMUST00000064797] [ENSMUST00000113993] [ENSMUST00000113996] [ENSMUST00000113999] [ENSMUST00000114001] [ENSMUST00000114002] [ENSMUST00000159295]
Predicted Effect unknown
Transcript: ENSMUST00000056482
AA Change: G1132R
SMART Domains Protein: ENSMUSP00000056011
Gene: ENSMUSG00000022957
AA Change: G1132R

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 798 1.05e-19 SMART
SH3 909 963 2.64e-16 SMART
SH3 998 1052 1.82e-19 SMART
SH3 1070 1130 2.46e-16 SMART
SH3 1151 1206 7.97e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000064797
AA Change: G1137R
SMART Domains Protein: ENSMUSP00000066361
Gene: ENSMUSG00000022957
AA Change: G1137R

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 803 1.62e-16 SMART
SH3 914 968 2.64e-16 SMART
SH3 1003 1057 1.82e-19 SMART
SH3 1075 1135 2.46e-16 SMART
SH3 1156 1211 7.97e-25 SMART
RhoGEF 1239 1420 1e-63 SMART
PH 1461 1571 6.07e-13 SMART
C2 1595 1692 1.58e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113993
AA Change: G1066R
SMART Domains Protein: ENSMUSP00000109626
Gene: ENSMUSG00000022957
AA Change: G1066R

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 803 1.62e-16 SMART
SH3 914 968 2.64e-16 SMART
SH3 1004 1064 2.46e-16 SMART
SH3 1085 1140 7.97e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113996
AA Change: G1061R
SMART Domains Protein: ENSMUSP00000109629
Gene: ENSMUSG00000022957
AA Change: G1061R

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 798 1.05e-19 SMART
SH3 909 963 2.64e-16 SMART
SH3 999 1059 2.46e-16 SMART
SH3 1080 1135 7.97e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113999
AA Change: G1137R
SMART Domains Protein: ENSMUSP00000109632
Gene: ENSMUSG00000022957
AA Change: G1137R

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 803 1.62e-16 SMART
SH3 914 968 2.64e-16 SMART
SH3 1003 1057 1.82e-19 SMART
SH3 1075 1135 2.46e-16 SMART
SH3 1156 1211 7.97e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114001
AA Change: G1095R
SMART Domains Protein: ENSMUSP00000109634
Gene: ENSMUSG00000022957
AA Change: G1095R

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 145 155 N/A INTRINSIC
EH 177 272 2.55e-49 SMART
EFh 221 249 1.77e-2 SMART
low complexity region 293 305 N/A INTRINSIC
coiled coil region 315 410 N/A INTRINSIC
coiled coil region 431 478 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
coiled coil region 524 624 N/A INTRINSIC
low complexity region 650 659 N/A INTRINSIC
SH3 704 761 1.05e-19 SMART
SH3 872 926 2.64e-16 SMART
SH3 961 1015 1.82e-19 SMART
SH3 1033 1093 2.46e-16 SMART
SH3 1114 1169 7.97e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114002
AA Change: G1132R
SMART Domains Protein: ENSMUSP00000109635
Gene: ENSMUSG00000022957
AA Change: G1132R

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 798 1.05e-19 SMART
SH3 909 963 2.64e-16 SMART
SH3 998 1052 1.82e-19 SMART
SH3 1070 1130 2.46e-16 SMART
SH3 1151 1206 7.97e-25 SMART
RhoGEF 1234 1415 1e-63 SMART
PH 1456 1566 6.07e-13 SMART
C2 1590 1687 1.58e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126374
SMART Domains Protein: ENSMUSP00000114718
Gene: ENSMUSG00000022957

DomainStartEndE-ValueType
Pfam:SH3_2 1 22 2.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159295
SMART Domains Protein: ENSMUSP00000125172
Gene: ENSMUSG00000116933

DomainStartEndE-ValueType
Pfam:OSCP 1 89 1.1e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic membrane-associated protein that indirectly coordinates endocytic membrane traffic with the actin assembly machinery. In addition, the encoded protein may regulate the formation of clathrin-coated vesicles and could be involved in synaptic vesicle recycling. This protein has been shown to interact with dynamin, CDC42, SNAP23, SNAP25, SPIN90, EPS15, EPN1, EPN2, and STN2. Multiple transcript variants encoding different isoforms have been found for this gene, but the full-length nature of only two of them have been characterized so far. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous for a gene trapped allele exhibit embryonic lethal. Mice homozygous for a null allele exhibit some postnatal lethality and impaired vesicle recycling in surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,102 C148S probably damaging Het
4921530L21Rik A G 14: 95,882,112 R102G probably benign Het
A230050P20Rik C T 9: 20,868,859 probably benign Het
Agap2 A G 10: 127,091,088 D1018G probably damaging Het
Atm T C 9: 53,522,239 N237S possibly damaging Het
Card6 G T 15: 5,098,423 Q1164K unknown Het
Cped1 G A 6: 22,222,431 C730Y probably damaging Het
Csmd1 A T 8: 15,931,108 L2770Q probably damaging Het
Ctsw T C 19: 5,467,044 T87A probably damaging Het
Dock4 T C 12: 40,806,975 I1269T probably damaging Het
F11 T C 8: 45,252,090 E138G possibly damaging Het
Fam124b A G 1: 80,200,257 S342P probably damaging Het
Fam71d T C 12: 78,712,133 S76P probably damaging Het
Gipr T C 7: 19,162,959 I129V probably benign Het
Gm5415 T C 1: 32,546,097 D244G probably benign Het
Gria4 A T 9: 4,464,288 V558D probably damaging Het
Gsdme C T 6: 50,229,308 G185E probably damaging Het
Hgd T A 16: 37,593,435 D86E probably benign Het
Hmcn1 T A 1: 150,646,709 H3480L probably benign Het
Hs2st1 T C 3: 144,454,022 N127D probably damaging Het
Ilf3 A G 9: 21,399,537 N599S possibly damaging Het
Jakmip2 A G 18: 43,571,908 S343P possibly damaging Het
Kif1b A G 4: 149,182,355 V1670A probably benign Het
Lman2 A T 13: 55,353,077 probably null Het
Ltbp1 A T 17: 75,385,124 Y1579F probably damaging Het
Mon2 G A 10: 123,032,588 A520V probably benign Het
Mrpl10 T G 11: 97,047,537 V171G possibly damaging Het
Mrps27 A T 13: 99,401,330 T153S unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nlrp10 A G 7: 108,924,488 V595A probably benign Het
Nol4 A T 18: 23,040,023 M7K probably benign Het
Oasl1 G A 5: 114,929,921 S188N probably damaging Het
Olfr193 T C 16: 59,109,771 I280V probably benign Het
Olfr709-ps1 C A 7: 106,927,411 G16V probably benign Het
Pcdhga2 A G 18: 37,669,940 Y279C probably damaging Het
Pfpl C T 19: 12,429,174 A263V probably benign Het
Phf3 T G 1: 30,829,857 K703N probably damaging Het
Pik3ca C G 3: 32,436,218 P5A probably damaging Het
Plekha6 T C 1: 133,293,707 V987A probably damaging Het
Ppp3ca T A 3: 136,890,489 I305N probably damaging Het
Prex2 A G 1: 11,181,937 K1069E possibly damaging Het
Prss50 T C 9: 110,861,335 V182A probably damaging Het
Ptprg A G 14: 12,211,703 N995S probably benign Het
Robo2 C A 16: 73,897,015 G1375V probably benign Het
Rtl1 T C 12: 109,594,430 Y325C possibly damaging Het
Shcbp1 A C 8: 4,748,720 S400A probably damaging Het
Sirpb1c T A 3: 15,832,072 Y380F probably benign Het
Tbl2 G C 5: 135,159,475 L374F probably damaging Het
Tpr C A 1: 150,429,532 A1524E possibly damaging Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Vps16 C T 2: 130,441,703 Q606* probably null Het
Vstm5 A T 9: 15,239,356 Q29L probably benign Het
Wipi1 G T 11: 109,582,423 S250Y probably damaging Het
Other mutations in Itsn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Itsn1 APN 16 91806201 unclassified probably benign
IGL01799:Itsn1 APN 16 91848882 missense probably damaging 1.00
IGL02328:Itsn1 APN 16 91815407 missense probably damaging 1.00
IGL02333:Itsn1 APN 16 91820676 intron probably benign
IGL02503:Itsn1 APN 16 91889204 missense possibly damaging 0.62
IGL02628:Itsn1 APN 16 91899623 missense possibly damaging 0.79
IGL02666:Itsn1 APN 16 91820718 intron probably benign
IGL03007:Itsn1 APN 16 91784162 splice site probably benign
IGL03223:Itsn1 APN 16 91905306 missense probably benign 0.00
raphael UTSW 16 91820796 intron probably benign
weevil UTSW 16 91818552 intron probably benign
R0234:Itsn1 UTSW 16 91828280 nonsense probably null
R0234:Itsn1 UTSW 16 91828280 nonsense probably null
R0255:Itsn1 UTSW 16 91806090 unclassified probably benign
R0432:Itsn1 UTSW 16 91815520 missense probably damaging 1.00
R0455:Itsn1 UTSW 16 91868148 intron probably benign
R0471:Itsn1 UTSW 16 91899589 missense probably damaging 1.00
R0558:Itsn1 UTSW 16 91899623 missense possibly damaging 0.79
R0563:Itsn1 UTSW 16 91820796 intron probably benign
R1657:Itsn1 UTSW 16 91909223 missense probably damaging 1.00
R1671:Itsn1 UTSW 16 91812150 missense probably damaging 1.00
R1742:Itsn1 UTSW 16 91816959 critical splice donor site probably null
R1859:Itsn1 UTSW 16 91889154 intron probably benign
R1898:Itsn1 UTSW 16 91899580 missense probably damaging 1.00
R2016:Itsn1 UTSW 16 91905501 critical splice donor site probably null
R2221:Itsn1 UTSW 16 91853768 intron probably benign
R2244:Itsn1 UTSW 16 91853771 missense probably null
R3160:Itsn1 UTSW 16 91853044 nonsense probably null
R3162:Itsn1 UTSW 16 91853044 nonsense probably null
R3814:Itsn1 UTSW 16 91852921 missense possibly damaging 0.96
R4162:Itsn1 UTSW 16 91852902 missense probably benign 0.00
R4254:Itsn1 UTSW 16 91818552 intron probably benign
R4319:Itsn1 UTSW 16 91818552 intron probably benign
R4321:Itsn1 UTSW 16 91818552 intron probably benign
R4323:Itsn1 UTSW 16 91818552 intron probably benign
R4326:Itsn1 UTSW 16 91853855 intron probably benign
R4515:Itsn1 UTSW 16 91899649 missense probably damaging 0.99
R4584:Itsn1 UTSW 16 91820583 intron probably benign
R4600:Itsn1 UTSW 16 91899587 missense probably damaging 1.00
R4649:Itsn1 UTSW 16 91841588 missense probably damaging 1.00
R4834:Itsn1 UTSW 16 91906789 nonsense probably null
R4868:Itsn1 UTSW 16 91785317 missense probably damaging 0.98
R5036:Itsn1 UTSW 16 91782235 splice site probably benign
R5122:Itsn1 UTSW 16 91893844 intron probably benign
R5161:Itsn1 UTSW 16 91908838 missense possibly damaging 0.95
R5437:Itsn1 UTSW 16 91818591 intron probably benign
R5538:Itsn1 UTSW 16 91784102 missense probably damaging 1.00
R5683:Itsn1 UTSW 16 91905380 missense probably benign 0.00
R5697:Itsn1 UTSW 16 91801589 missense possibly damaging 0.56
R5749:Itsn1 UTSW 16 91906855 missense probably damaging 0.99
R6083:Itsn1 UTSW 16 91853011 missense probably benign 0.01
R6148:Itsn1 UTSW 16 91816852 missense probably damaging 1.00
R6291:Itsn1 UTSW 16 91868096 intron probably benign
R6524:Itsn1 UTSW 16 91911995 missense probably damaging 0.96
R7175:Itsn1 UTSW 16 91868050 missense unknown
R7261:Itsn1 UTSW 16 91905306 missense probably benign 0.00
R7320:Itsn1 UTSW 16 91839699 missense unknown
R7366:Itsn1 UTSW 16 91908450 missense unknown
R7462:Itsn1 UTSW 16 91853185 missense possibly damaging 0.53
R7665:Itsn1 UTSW 16 91841603 missense unknown
R7856:Itsn1 UTSW 16 91908487 critical splice donor site probably null
R7864:Itsn1 UTSW 16 91801566 missense possibly damaging 0.47
R7896:Itsn1 UTSW 16 91818558 missense unknown
R7897:Itsn1 UTSW 16 91818558 missense unknown
R7939:Itsn1 UTSW 16 91908487 critical splice donor site probably null
R7947:Itsn1 UTSW 16 91801566 missense possibly damaging 0.47
R7979:Itsn1 UTSW 16 91818558 missense unknown
R7980:Itsn1 UTSW 16 91818558 missense unknown
R7998:Itsn1 UTSW 16 91850936 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAATTTCTGTGACAGTCCTTTG -3'
(R):5'- CGCATTTCCAACTGCTCCAG -3'

Sequencing Primer
(F):5'- GTGACAGTCCTTTGTCTCTCAG -3'
(R):5'- TCCAGCAGAGTCCAGTGAG -3'
Posted On2019-11-12