Incidental Mutation 'R7720:Jakmip2'
ID 595201
Institutional Source Beutler Lab
Gene Symbol Jakmip2
Ensembl Gene ENSMUSG00000024502
Gene Name janus kinase and microtubule interacting protein 2
Synonyms 6430702L21Rik, D930046L20Rik
MMRRC Submission 067892-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.316) question?
Stock # R7720 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 43664472-43820838 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43704973 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 343 (S343P)
Ref Sequence ENSEMBL: ENSMUSP00000080881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082254]
AlphaFold D3YXK0
Predicted Effect possibly damaging
Transcript: ENSMUST00000082254
AA Change: S343P

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080881
Gene: ENSMUSG00000024502
AA Change: S343P

DomainStartEndE-ValueType
coiled coil region 13 102 N/A INTRINSIC
coiled coil region 206 249 N/A INTRINSIC
Pfam:JAKMIP_CC3 409 602 2.3e-86 PFAM
coiled coil region 698 808 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is reported to be a component of the Golgi matrix. It may act as a golgin protein by negatively regulating transit of secretory cargo and by acting as a structural scaffold of the Golgi. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 126,926,957 (GRCm39) D1018G probably damaging Het
Atm T C 9: 53,433,539 (GRCm39) N237S possibly damaging Het
Card6 G T 15: 5,127,905 (GRCm39) Q1164K unknown Het
Ccdc202 A G 14: 96,119,548 (GRCm39) R102G probably benign Het
Cped1 G A 6: 22,222,430 (GRCm39) C730Y probably damaging Het
Csmd1 A T 8: 15,981,108 (GRCm39) L2770Q probably damaging Het
Ctsw T C 19: 5,517,072 (GRCm39) T87A probably damaging Het
Dock4 T C 12: 40,856,974 (GRCm39) I1269T probably damaging Het
F11 T C 8: 45,705,127 (GRCm39) E138G possibly damaging Het
Fam124b A G 1: 80,177,974 (GRCm39) S342P probably damaging Het
Garin2 T C 12: 78,758,907 (GRCm39) S76P probably damaging Het
Gipr T C 7: 18,896,884 (GRCm39) I129V probably benign Het
Gria4 A T 9: 4,464,288 (GRCm39) V558D probably damaging Het
Gsdme C T 6: 50,206,288 (GRCm39) G185E probably damaging Het
Hapstr1 T A 16: 8,660,966 (GRCm39) C148S probably damaging Het
Hgd T A 16: 37,413,797 (GRCm39) D86E probably benign Het
Hmcn1 T A 1: 150,522,460 (GRCm39) H3480L probably benign Het
Hs2st1 T C 3: 144,159,783 (GRCm39) N127D probably damaging Het
Ilf3 A G 9: 21,310,833 (GRCm39) N599S possibly damaging Het
Itsn1 G A 16: 91,664,971 (GRCm39) G1132R unknown Het
Kif1b A G 4: 149,266,812 (GRCm39) V1670A probably benign Het
Lman2 A T 13: 55,500,890 (GRCm39) probably null Het
Ltbp1 A T 17: 75,692,119 (GRCm39) Y1579F probably damaging Het
Mon2 G A 10: 122,868,493 (GRCm39) A520V probably benign Het
Mrpl10 T G 11: 96,938,363 (GRCm39) V171G possibly damaging Het
Mrps27 A T 13: 99,537,838 (GRCm39) T153S unknown Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Nlrp10 A G 7: 108,523,695 (GRCm39) V595A probably benign Het
Nol4 A T 18: 23,173,080 (GRCm39) M7K probably benign Het
Oasl1 G A 5: 115,067,980 (GRCm39) S188N probably damaging Het
Or2d3c C A 7: 106,526,618 (GRCm39) G16V probably benign Het
Or5h25 T C 16: 58,930,134 (GRCm39) I280V probably benign Het
Pcdhga2 A G 18: 37,802,993 (GRCm39) Y279C probably damaging Het
Pfpl C T 19: 12,406,538 (GRCm39) A263V probably benign Het
Phf3 T G 1: 30,868,938 (GRCm39) K703N probably damaging Het
Pik3ca C G 3: 32,490,367 (GRCm39) P5A probably damaging Het
Plekha6 T C 1: 133,221,445 (GRCm39) V987A probably damaging Het
Ppp3ca T A 3: 136,596,250 (GRCm39) I305N probably damaging Het
Prex2 A G 1: 11,252,161 (GRCm39) K1069E possibly damaging Het
Prss50 T C 9: 110,690,403 (GRCm39) V182A probably damaging Het
Ptprg A G 14: 12,211,703 (GRCm38) N995S probably benign Het
Robo2 C A 16: 73,693,903 (GRCm39) G1375V probably benign Het
Rtl1 T C 12: 109,560,864 (GRCm39) Y325C possibly damaging Het
Semp2l1 T C 1: 32,585,178 (GRCm39) D244G probably benign Het
Shcbp1 A C 8: 4,798,720 (GRCm39) S400A probably damaging Het
Shfl C T 9: 20,780,155 (GRCm39) probably benign Het
Sirpb1c T A 3: 15,886,236 (GRCm39) Y380F probably benign Het
Tbl2 G C 5: 135,188,329 (GRCm39) L374F probably damaging Het
Tpr C A 1: 150,305,283 (GRCm39) A1524E possibly damaging Het
Vmn2r45 T A 7: 8,486,460 (GRCm39) E276V probably damaging Het
Vps16 C T 2: 130,283,623 (GRCm39) Q606* probably null Het
Vstm5 A T 9: 15,150,652 (GRCm39) Q29L probably benign Het
Wipi1 G T 11: 109,473,249 (GRCm39) S250Y probably damaging Het
Other mutations in Jakmip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Jakmip2 APN 18 43,723,744 (GRCm39) utr 5 prime probably benign
IGL01311:Jakmip2 APN 18 43,690,389 (GRCm39) splice site probably benign
IGL01467:Jakmip2 APN 18 43,715,352 (GRCm39) missense probably benign 0.34
IGL01947:Jakmip2 APN 18 43,680,159 (GRCm39) missense probably benign 0.00
IGL02010:Jakmip2 APN 18 43,692,158 (GRCm39) critical splice donor site probably null
IGL02040:Jakmip2 APN 18 43,704,919 (GRCm39) missense probably benign
IGL02143:Jakmip2 APN 18 43,696,350 (GRCm39) missense probably damaging 1.00
IGL02246:Jakmip2 APN 18 43,700,223 (GRCm39) missense possibly damaging 0.82
IGL02350:Jakmip2 APN 18 43,680,192 (GRCm39) missense possibly damaging 0.46
IGL02357:Jakmip2 APN 18 43,680,192 (GRCm39) missense possibly damaging 0.46
IGL02725:Jakmip2 APN 18 43,695,655 (GRCm39) missense probably damaging 0.99
IGL02833:Jakmip2 APN 18 43,708,516 (GRCm39) splice site probably benign
IGL02866:Jakmip2 APN 18 43,685,266 (GRCm39) missense probably benign 0.28
IGL02981:Jakmip2 APN 18 43,695,595 (GRCm39) critical splice donor site probably null
R0042:Jakmip2 UTSW 18 43,685,210 (GRCm39) splice site probably benign
R0044:Jakmip2 UTSW 18 43,715,170 (GRCm39) missense probably benign
R0436:Jakmip2 UTSW 18 43,691,234 (GRCm39) nonsense probably null
R1453:Jakmip2 UTSW 18 43,692,279 (GRCm39) splice site probably null
R1682:Jakmip2 UTSW 18 43,714,896 (GRCm39) critical splice donor site probably null
R1829:Jakmip2 UTSW 18 43,715,145 (GRCm39) missense possibly damaging 0.93
R1908:Jakmip2 UTSW 18 43,700,209 (GRCm39) missense probably benign
R2070:Jakmip2 UTSW 18 43,696,395 (GRCm39) missense probably benign 0.34
R2168:Jakmip2 UTSW 18 43,698,995 (GRCm39) missense probably damaging 1.00
R2985:Jakmip2 UTSW 18 43,704,246 (GRCm39) missense possibly damaging 0.79
R3896:Jakmip2 UTSW 18 43,682,751 (GRCm39) missense probably benign 0.00
R4243:Jakmip2 UTSW 18 43,710,501 (GRCm39) missense probably benign 0.02
R4245:Jakmip2 UTSW 18 43,710,501 (GRCm39) missense probably benign 0.02
R4614:Jakmip2 UTSW 18 43,695,657 (GRCm39) missense probably damaging 1.00
R4687:Jakmip2 UTSW 18 43,710,477 (GRCm39) missense possibly damaging 0.52
R4830:Jakmip2 UTSW 18 43,700,208 (GRCm39) missense probably benign 0.00
R4852:Jakmip2 UTSW 18 43,710,465 (GRCm39) missense probably damaging 0.99
R5099:Jakmip2 UTSW 18 43,701,173 (GRCm39) missense probably benign 0.20
R5381:Jakmip2 UTSW 18 43,715,025 (GRCm39) missense probably damaging 1.00
R5753:Jakmip2 UTSW 18 43,692,181 (GRCm39) missense probably damaging 0.99
R5883:Jakmip2 UTSW 18 43,715,059 (GRCm39) missense possibly damaging 0.59
R6261:Jakmip2 UTSW 18 43,708,599 (GRCm39) missense probably benign 0.01
R6382:Jakmip2 UTSW 18 43,704,244 (GRCm39) missense possibly damaging 0.66
R6527:Jakmip2 UTSW 18 43,689,589 (GRCm39) missense possibly damaging 0.94
R6612:Jakmip2 UTSW 18 43,690,432 (GRCm39) missense probably damaging 1.00
R6679:Jakmip2 UTSW 18 43,699,014 (GRCm39) missense probably damaging 0.98
R7070:Jakmip2 UTSW 18 43,690,393 (GRCm39) critical splice donor site probably null
R7103:Jakmip2 UTSW 18 43,673,648 (GRCm39) splice site probably null
R7434:Jakmip2 UTSW 18 43,690,444 (GRCm39) missense possibly damaging 0.94
R7446:Jakmip2 UTSW 18 43,710,390 (GRCm39) missense probably damaging 1.00
R7515:Jakmip2 UTSW 18 43,704,191 (GRCm39) missense probably benign 0.01
R7586:Jakmip2 UTSW 18 43,673,676 (GRCm39) missense probably damaging 0.98
R7999:Jakmip2 UTSW 18 43,696,398 (GRCm39) missense probably benign 0.21
R9002:Jakmip2 UTSW 18 43,715,323 (GRCm39) missense probably benign 0.05
R9184:Jakmip2 UTSW 18 43,715,352 (GRCm39) missense probably benign 0.34
R9248:Jakmip2 UTSW 18 43,685,242 (GRCm39) missense probably benign 0.04
R9252:Jakmip2 UTSW 18 43,715,194 (GRCm39) missense possibly damaging 0.92
R9674:Jakmip2 UTSW 18 43,704,961 (GRCm39) missense probably benign
R9691:Jakmip2 UTSW 18 43,673,685 (GRCm39) missense probably damaging 0.99
R9788:Jakmip2 UTSW 18 43,704,927 (GRCm39) missense probably damaging 1.00
X0057:Jakmip2 UTSW 18 43,699,035 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CAAGGGAAAATCCAAGTGGTTG -3'
(R):5'- GGGCTGTTTTCCTTGTTCACA -3'

Sequencing Primer
(F):5'- AGTGGTTGGTACACACACAC -3'
(R):5'- GCTGTTTTCCTTGTTCACACCTGAC -3'
Posted On 2019-11-12