Incidental Mutation 'R7721:Prex1'
ID595209
Institutional Source Beutler Lab
Gene Symbol Prex1
Ensembl Gene ENSMUSG00000039621
Gene Namephosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
SynonymsP-REX1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R7721 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location166566342-166713832 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 166577890 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1289 (Q1289*)
Ref Sequence ENSEMBL: ENSMUSP00000037180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036719] [ENSMUST00000099080] [ENSMUST00000109246]
Predicted Effect probably null
Transcript: ENSMUST00000036719
AA Change: Q1289*
SMART Domains Protein: ENSMUSP00000037180
Gene: ENSMUSG00000039621
AA Change: Q1289*

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
RhoGEF 48 234 3.16e-52 SMART
PH 267 389 1.02e-10 SMART
DEP 418 491 6.86e-27 SMART
DEP 519 592 3.06e-24 SMART
PDZ 628 701 4.55e-1 SMART
PDZ 712 783 5.66e-1 SMART
low complexity region 800 811 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1109 1127 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099080
AA Change: Q1119*
SMART Domains Protein: ENSMUSP00000096679
Gene: ENSMUSG00000039621
AA Change: Q1119*

DomainStartEndE-ValueType
Pfam:RhoGEF 5 64 3.8e-18 PFAM
PH 97 219 1.02e-10 SMART
DEP 248 321 6.86e-27 SMART
DEP 349 422 3.06e-24 SMART
PDZ 458 531 4.55e-1 SMART
PDZ 542 613 5.66e-1 SMART
low complexity region 630 641 N/A INTRINSIC
low complexity region 644 655 N/A INTRINSIC
low complexity region 939 957 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109246
AA Change: Q101*
SMART Domains Protein: ENSMUSP00000104869
Gene: ENSMUSG00000039621
AA Change: Q101*

DomainStartEndE-ValueType
low complexity region 357 367 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It has been shown to bind to and activate RAC1 by exchanging bound GDP for free GTP. The encoded protein, which is found mainly in the cytoplasm, is activated by phosphatidylinositol-3,4,5-trisphosphate and the beta-gamma subunits of heterotrimeric G proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have impaired neutrophil migration and autism-like social behavior with defective AMPA-mediated LTD. Mice with other alleles exhibit reduced weight, smaller livers and increased peripheral neutrophil numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik T A 11: 69,121,526 T9S unknown Het
A630095E13Rik C T 9: 36,637,863 G34R possibly damaging Het
Adamtsl3 T G 7: 82,606,520 M1580R possibly damaging Het
Alg9 T C 9: 50,776,642 I78T probably damaging Het
Ankrd11 G T 8: 122,894,759 L785M probably damaging Het
Atrnl1 T A 19: 57,696,331 D796E probably benign Het
C1s2 A G 6: 124,630,058 V277A possibly damaging Het
Cldn15 A G 5: 136,968,161 M19V probably benign Het
Cldn23 T G 8: 35,826,263 S24R possibly damaging Het
Cnr1 T A 4: 33,944,416 I268N probably damaging Het
Csf2ra A T 19: 61,226,586 W147R probably damaging Het
Ctsb G T 14: 63,133,316 probably benign Het
D430041D05Rik A G 2: 104,258,529 M34T probably benign Het
Dmtf1 T C 5: 9,126,564 I463V probably damaging Het
Dnah7a T A 1: 53,631,683 D470V probably benign Het
Dtx4 A G 19: 12,482,136 S435P probably benign Het
Ear2 T A 14: 44,103,038 M51K probably damaging Het
Faf1 T A 4: 109,736,597 I124N probably damaging Het
Gkap1 A C 13: 58,236,985 probably null Het
Glipr2 T C 4: 43,957,770 S4P probably benign Het
Gm11639 T A 11: 104,724,540 L711* probably null Het
Gm38119 A T 3: 92,738,030 C86S unknown Het
Gm6583 A G 5: 112,355,517 I107T probably benign Het
Gpr171 T G 3: 59,097,899 I152L probably benign Het
Homer3 T C 8: 70,291,012 V180A probably benign Het
Irx1 T A 13: 71,960,057 M169L probably benign Het
Kap A G 6: 133,851,727 probably null Het
Lyzl4 GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAAGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG 9: 121,583,989 probably null Het
Mgat5b A G 11: 116,966,801 M2V Het
Mob4 C T 1: 55,148,320 Q76* probably null Het
Olfr1493-ps1 T A 19: 13,726,843 I194N possibly damaging Het
Olfr911-ps1 A T 9: 38,523,717 probably null Het
Olfr943 A G 9: 39,184,760 D191G probably benign Het
Pcdha9 A T 18: 36,999,636 Q586L probably benign Het
Pgk2 T A 17: 40,207,518 I340F probably benign Het
Prr22 A G 17: 56,771,819 D324G possibly damaging Het
Rab2b A T 14: 52,263,760 S201T probably benign Het
Rdh1 T A 10: 127,760,252 probably null Het
Rhbdl1 G T 17: 25,836,149 N82K probably benign Het
Rspo1 C A 4: 124,991,417 Q29K possibly damaging Het
Rtp3 A T 9: 110,985,880 Y472* probably null Het
Senp5 T A 16: 31,990,434 M1L unknown Het
Stab1 A G 14: 31,141,456 V2091A possibly damaging Het
Stk32c A G 7: 139,188,153 S71P possibly damaging Het
Tpr A G 1: 150,444,429 T2243A probably benign Het
Tubgcp6 A T 15: 89,101,401 N1544K probably damaging Het
Uqcc1 T C 2: 155,858,146 N202S probably benign Het
Vmn2r18 C T 5: 151,586,693 E72K possibly damaging Het
Zfp654 C A 16: 64,786,207 C3F probably damaging Het
Zfp804b T C 5: 6,771,263 E600G possibly damaging Het
Other mutations in Prex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Prex1 APN 2 166638401 missense probably damaging 1.00
IGL00309:Prex1 APN 2 166609823 missense probably damaging 0.99
IGL00953:Prex1 APN 2 166638409 missense probably damaging 1.00
IGL00961:Prex1 APN 2 166585736 missense probably damaging 0.98
IGL01300:Prex1 APN 2 166638407 missense possibly damaging 0.46
IGL01318:Prex1 APN 2 166569340 splice site probably benign
IGL01753:Prex1 APN 2 166602882 missense probably benign 0.11
IGL01819:Prex1 APN 2 166621245 missense probably damaging 1.00
IGL02058:Prex1 APN 2 166585183 missense probably benign 0.00
IGL02251:Prex1 APN 2 166577886 missense probably damaging 0.99
IGL02326:Prex1 APN 2 166621185 missense probably benign 0.35
IGL02366:Prex1 APN 2 166580427 missense probably damaging 1.00
IGL02414:Prex1 APN 2 166609828 missense probably damaging 1.00
IGL02660:Prex1 APN 2 166593867 missense probably damaging 0.97
IGL02666:Prex1 APN 2 166572989 missense probably benign 0.00
IGL02874:Prex1 APN 2 166585047 missense probably damaging 1.00
IGL02935:Prex1 APN 2 166570345 missense probably damaging 1.00
IGL03179:Prex1 APN 2 166585194 missense probably benign 0.31
R0207:Prex1 UTSW 2 166585898 missense possibly damaging 0.92
R0415:Prex1 UTSW 2 166586699 unclassified probably benign
R0420:Prex1 UTSW 2 166589571 missense probably benign 0.13
R0449:Prex1 UTSW 2 166569377 missense probably benign 0.16
R0458:Prex1 UTSW 2 166585823 missense probably damaging 0.99
R0927:Prex1 UTSW 2 166586537 missense probably benign 0.01
R1299:Prex1 UTSW 2 166585907 missense possibly damaging 0.62
R1414:Prex1 UTSW 2 166593861 missense probably damaging 1.00
R1440:Prex1 UTSW 2 166580463 missense probably damaging 0.98
R1506:Prex1 UTSW 2 166587081 missense probably damaging 1.00
R1725:Prex1 UTSW 2 166601736 missense probably damaging 1.00
R1831:Prex1 UTSW 2 166585101 missense probably damaging 1.00
R1883:Prex1 UTSW 2 166583272 missense probably benign 0.20
R1896:Prex1 UTSW 2 166586654 missense probably benign 0.01
R2022:Prex1 UTSW 2 166575614 missense possibly damaging 0.80
R2091:Prex1 UTSW 2 166569365 missense possibly damaging 0.95
R2258:Prex1 UTSW 2 166587157 missense probably benign 0.00
R2263:Prex1 UTSW 2 166589068 splice site probably benign
R2276:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2279:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2680:Prex1 UTSW 2 166601772 missense possibly damaging 0.92
R3024:Prex1 UTSW 2 166589036 missense probably benign 0.04
R3421:Prex1 UTSW 2 166617854 missense probably damaging 1.00
R3614:Prex1 UTSW 2 166609781 missense probably damaging 1.00
R4244:Prex1 UTSW 2 166570336 missense probably damaging 1.00
R4605:Prex1 UTSW 2 166713544 missense probably benign 0.45
R4685:Prex1 UTSW 2 166638332 missense probably damaging 0.97
R4787:Prex1 UTSW 2 166638340 missense probably benign 0.01
R4796:Prex1 UTSW 2 166592291 missense probably damaging 1.00
R4825:Prex1 UTSW 2 166585857 nonsense probably null
R4955:Prex1 UTSW 2 166573223 missense probably damaging 0.99
R5046:Prex1 UTSW 2 166572963 missense probably benign 0.00
R5095:Prex1 UTSW 2 166581921 missense probably damaging 1.00
R5408:Prex1 UTSW 2 166575653 small insertion probably benign
R5462:Prex1 UTSW 2 166644808 missense probably benign 0.02
R5535:Prex1 UTSW 2 166580273 missense possibly damaging 0.80
R5777:Prex1 UTSW 2 166586659 missense probably damaging 1.00
R5813:Prex1 UTSW 2 166583207 missense probably benign
R5860:Prex1 UTSW 2 166644684 intron probably benign
R5984:Prex1 UTSW 2 166585744 missense probably damaging 1.00
R6009:Prex1 UTSW 2 166581984 missense probably damaging 1.00
R6174:Prex1 UTSW 2 166572963 missense probably benign 0.00
R6345:Prex1 UTSW 2 166572960 missense probably null 0.81
R6897:Prex1 UTSW 2 166581993 missense probably damaging 0.99
R6935:Prex1 UTSW 2 166599655 missense probably damaging 1.00
R7025:Prex1 UTSW 2 166613187 small insertion probably benign
R7037:Prex1 UTSW 2 166587180 missense probably benign 0.05
R7076:Prex1 UTSW 2 166633382 missense probably damaging 0.99
R7181:Prex1 UTSW 2 166570371 missense probably damaging 1.00
R7361:Prex1 UTSW 2 166713570 missense probably benign 0.04
R7381:Prex1 UTSW 2 166587127 missense probably damaging 1.00
R7763:Prex1 UTSW 2 166713709 missense unknown
R7809:Prex1 UTSW 2 166573244 missense possibly damaging 0.91
R7998:Prex1 UTSW 2 166587045 critical splice donor site probably null
R8029:Prex1 UTSW 2 166575603 missense probably benign 0.01
X0065:Prex1 UTSW 2 166586625 missense probably benign
Z1176:Prex1 UTSW 2 166572970 nonsense probably null
Z1177:Prex1 UTSW 2 166592228 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGCCTCAGTAGAAATGGCCC -3'
(R):5'- ACCCATCAGTTTCCTTGACATAGG -3'

Sequencing Primer
(F):5'- CCATTTCCATGGGTCCTCTAG -3'
(R):5'- CCTTGACATAGGGTAGTGAGC -3'
Posted On2019-11-12