Mutagenetix > Incidental Mutation

Incidental Mutation 'R0242:Sptan1'

59521

Institutional Source

Beutler Lab

Gene Symbol

Sptan1

Ensembl Gene

ENSMUSG00000057738

Gene Name

spectrin alpha, non-erythrocytic 1

Synonyms

alpha-fodrin, Spna2, 2610027H02Rik, Spna-2

MMRRC Submission

038480-MU

Accession Numbers

Ncbi RefSeq: NM_001076554.2, NM_001177667.1, NM_001177668.1; MGI:98386

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0242 (G1)

Quality Score

134

Status

Validated

Chromosome

Chromosomal Location

29965560-30031451 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 30018401 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1725 (M1725L)

Ref Sequence

ENSEMBL: ENSMUSP00000092697 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]

AlphaFold

P16546

Predicted Effect

probably benign
Transcript: ENSMUST00000046257
AA Change: M1705L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738
AA Change: M1705L

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1635	9.65e-30	SMART
SPEC	1641	1741	2.32e-32	SMART
SPEC	1747	1847	6.98e-36	SMART
SPEC	1853	1953	1.53e-32	SMART
SPEC	1959	2060	6.23e-24	SMART
SPEC	2074	2174	2.08e-11	SMART
SPEC	2188	2289	1.07e-4	SMART
EFh	2307	2335	5.78e-7	SMART
EFh	2350	2378	3.85e-3	SMART
efhand_Ca_insen	2382	2451	6.74e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000095083
AA Change: M1725L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738
AA Change: M1725L

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1088	1.56e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1094	1230	6.52e-27	SMART
SPEC	1236	1336	1.44e-37	SMART
SPEC	1342	1442	4.43e-29	SMART
SPEC	1448	1548	7.54e-32	SMART
SPEC	1554	1655	9.65e-30	SMART
SPEC	1661	1761	2.32e-32	SMART
SPEC	1767	1867	6.98e-36	SMART
SPEC	1873	1973	1.53e-32	SMART
SPEC	1979	2080	6.23e-24	SMART
SPEC	2094	2194	2.08e-11	SMART
SPEC	2208	2309	1.07e-4	SMART
EFh	2327	2355	5.78e-7	SMART
EFh	2370	2398	3.85e-3	SMART
efhand_Ca_insen	2402	2471	6.74e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000100225
AA Change: M1730L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738
AA Change: M1730L

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1088	1.56e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1094	1230	6.52e-27	SMART
SPEC	1236	1336	1.44e-37	SMART
SPEC	1342	1442	4.43e-29	SMART
SPEC	1448	1548	7.54e-32	SMART
SPEC	1554	1660	2.06e-24	SMART
SPEC	1666	1766	2.32e-32	SMART
SPEC	1772	1872	6.98e-36	SMART
SPEC	1878	1978	1.53e-32	SMART
SPEC	1984	2085	6.23e-24	SMART
SPEC	2099	2199	2.08e-11	SMART
SPEC	2213	2314	1.07e-4	SMART
EFh	2332	2360	5.78e-7	SMART
EFh	2375	2403	3.85e-3	SMART
efhand_Ca_insen	2407	2476	6.74e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113717
AA Change: M1710L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738
AA Change: M1710L

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1640	2.06e-24	SMART
SPEC	1646	1746	2.32e-32	SMART
SPEC	1752	1852	6.98e-36	SMART
SPEC	1858	1958	1.53e-32	SMART
SPEC	1964	2065	6.23e-24	SMART
SPEC	2079	2179	2.08e-11	SMART
SPEC	2193	2294	1.07e-4	SMART
EFh	2312	2340	5.78e-7	SMART
EFh	2355	2383	3.85e-3	SMART
efhand_Ca_insen	2387	2456	6.74e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113719
AA Change: M1710L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738
AA Change: M1710L

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1640	2.06e-24	SMART
SPEC	1646	1746	2.32e-32	SMART
SPEC	1752	1852	6.98e-36	SMART
SPEC	1858	1958	1.53e-32	SMART
SPEC	1964	2065	6.23e-24	SMART
SPEC	2079	2179	2.08e-11	SMART
SPEC	2193	2315	3.27e0	SMART
EFh	2333	2361	5.78e-7	SMART
EFh	2376	2404	3.85e-3	SMART
efhand_Ca_insen	2408	2477	6.74e-32	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000129241
AA Change: M1730L

SMART Domains

Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738
AA Change: M1730L

Domain	Start	End	E-Value	Type
Pfam:Spectrin	1	65	9.9e-10	PFAM
SPEC	78	178	2.08e-11	SMART
SPEC	192	314	3.27e0	SMART
EFh	332	360	5.78e-7	SMART
EFh	375	403	3.85e-3	SMART
efhand_Ca_insen	407	476	6.74e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149846

Meta Mutation Damage Score

0.0632

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.5%

Validation Efficiency

97% (110/113)

MGI Phenotype

Strain: 3714925; 4330132
Lethality: E12-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]

Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029H14Rik	T	C	8: 13,551,676	D230G	probably benign	Het
4930435E12Rik	C	T	16: 38,824,567		probably benign	Het
Abhd13	A	G	8: 9,987,561	I53V	probably benign	Het
Adgrl2	A	C	3: 148,839,185		probably null	Het
Aldh16a1	G	A	7: 45,144,664	A596V	probably damaging	Het
Aldh3b2	T	A	19: 3,979,414	Y262*	probably null	Het
Ambn	A	G	5: 88,467,972	Q420R	possibly damaging	Het
Ankib1	A	C	5: 3,700,344		probably benign	Het
Arhgap9	C	A	10: 127,329,538	H430Q	probably benign	Het
Arhgef25	C	T	10: 127,184,064	G435E	probably damaging	Het
Armc12	A	T	17: 28,532,392	D120V	possibly damaging	Het
Armc4	A	T	18: 7,211,516	V786D	probably damaging	Het
Asxl3	G	A	18: 22,516,681	E576K	possibly damaging	Het
Bcdin3d	T	C	15: 99,470,895	E141G	probably benign	Het
Bmpr1b	G	A	3: 141,840,676	T483M	probably damaging	Het
Caprin2	C	T	6: 148,842,954	S991N	probably damaging	Het
Cd96	T	C	16: 46,071,766	I286M	possibly damaging	Het
Cdcp1	G	T	9: 123,180,172	F480L	probably benign	Het
Celf5	T	C	10: 81,464,409	T258A	probably benign	Het
Cgnl1	A	G	9: 71,721,657	V577A	probably damaging	Het
Clca3b	A	G	3: 144,841,465	S304P	probably benign	Het
Cmya5	A	T	13: 93,095,600	H993Q	probably benign	Het
Cnbp	A	T	6: 87,845,764	C6S	probably damaging	Het
Col14a1	C	T	15: 55,497,511	R1605W	probably damaging	Het
Cops7a	T	C	6: 124,964,854	N11S	probably benign	Het
Coro7	T	C	16: 4,630,178		probably benign	Het
Cpvl	T	C	6: 53,932,500	H217R	possibly damaging	Het
Cuedc1	T	C	11: 88,184,621		probably benign	Het
Cyp2c66	A	G	19: 39,141,925	Y68C	probably damaging	Het
Dicer1	G	A	12: 104,702,451	T1324M	probably benign	Het
Dlgap2	A	G	8: 14,727,562	D268G	probably benign	Het
Dnm1	T	A	2: 32,316,989	M535L	possibly damaging	Het
Dock7	A	T	4: 98,962,280	F1575Y	probably benign	Het
Dpp10	T	A	1: 123,398,546	H403L	possibly damaging	Het
Dync1h1	A	G	12: 110,649,851	D3112G	possibly damaging	Het
Eno3	A	G	11: 70,657,935	E21G	probably null	Het
Fam120b	T	A	17: 15,422,924	V655D	probably damaging	Het
Fam129a	A	G	1: 151,718,216	D884G	probably benign	Het
Fkbp5	A	T	17: 28,428,452	D136E	probably benign	Het
Gdap1l1	T	A	2: 163,447,653	Y179*	probably null	Het
Gfer	A	G	17: 24,694,303	W192R	probably damaging	Het
Gm4782	A	G	6: 50,609,858	T408A	probably benign	Het
Golgb1	C	T	16: 36,875,630	Q164*	probably null	Het
Gpnmb	A	G	6: 49,047,342	N197S	probably damaging	Het
Gtf2f1	G	A	17: 57,003,802	T414M	probably benign	Het
Hc	A	G	2: 35,036,154		probably benign	Het
Hcfc1	A	T	X: 73,948,429		probably benign	Het
Helz2	C	T	2: 181,230,430	R2539Q	probably damaging	Het
Hsd17b12	T	A	2: 94,157,815	I19F	probably benign	Het
Incenp	T	C	19: 9,893,750	T172A	unknown	Het
Jmy	A	G	13: 93,441,618	Y681H	probably benign	Het
Kbtbd11	A	G	8: 15,027,508	T36A	probably benign	Het
Kcnh4	T	C	11: 100,755,699	D267G	probably damaging	Het
Krt34	C	T	11: 100,041,331	E56K	probably damaging	Het
Krt40	T	A	11: 99,538,742	E335D	probably damaging	Het
Krt86	T	A	15: 101,476,573	Y282*	probably null	Het
Lgi3	C	T	14: 70,534,815	R267*	probably null	Het
Lnpk	A	G	2: 74,537,289		probably benign	Het
Lrp1b	T	A	2: 40,998,183	H2355L	probably benign	Het
Lrrc8e	G	A	8: 4,235,401	R542H	probably benign	Het
Mia2	T	C	12: 59,108,856	Y452H	probably damaging	Het
Mmachc	C	T	4: 116,704,541	R132Q	probably damaging	Het
Mtbp	T	A	15: 55,577,486	N356K	possibly damaging	Het
Mum1	T	C	10: 80,234,258	S354P	probably benign	Het
Myo5b	A	G	18: 74,661,716	H552R	possibly damaging	Het
Noxred1	A	G	12: 87,226,979	V96A	probably benign	Het
Nr1d2	T	A	14: 18,211,933	D390V	possibly damaging	Het
Oas1e	A	T	5: 120,791,774		probably benign	Het
Olfr398	T	C	11: 73,983,712	S299G	probably benign	Het
Olfr786	T	A	10: 129,437,348	Y179N	probably damaging	Het
Otog	G	T	7: 46,267,381	C914F	probably damaging	Het
Pank2	G	T	2: 131,280,197	C214F	probably damaging	Het
Pcdhb1	T	A	18: 37,266,735	S580T	probably benign	Het
Pdia3	T	C	2: 121,414,111	S2P	probably damaging	Het
Peli1	G	T	11: 21,142,602	R83L	probably damaging	Het
Pla2g3	T	A	11: 3,491,935	C366*	probably null	Het
Pon3	T	A	6: 5,240,860	D107V	probably benign	Het
Ppip5k2	A	G	1: 97,741,091	C532R	probably damaging	Het
Prph	A	T	15: 99,055,727	D174V	probably damaging	Het
Psd3	A	G	8: 67,758,086	M270T	probably damaging	Het
Pum3	A	G	19: 27,422,755		probably benign	Het
Pus1	A	T	5: 110,779,798	H30Q	probably benign	Het
Rab7	A	T	6: 88,005,132	V87E	probably damaging	Het
Rbm5	A	T	9: 107,751,708		probably benign	Het
Reln	A	G	5: 21,942,597		probably null	Het
S1pr3	A	G	13: 51,418,902	T40A	probably benign	Het
Sdk1	T	A	5: 142,143,922		probably benign	Het
Senp7	T	A	16: 56,179,521	I853N	probably damaging	Het
Serpinb6c	T	A	13: 33,899,247		probably benign	Het
Shroom1	T	G	11: 53,465,485		probably null	Het
Slc24a3	T	C	2: 145,606,664	I376T	probably benign	Het
Slc46a1	T	C	11: 78,468,667	I375T	possibly damaging	Het
Slc4a9	T	C	18: 36,533,680	F527S	probably damaging	Het
Slc4a9	T	A	18: 36,541,233	I924N	probably damaging	Het
Slx4	T	A	16: 3,986,952	E666V	probably damaging	Het
Snrnp27	G	A	6: 86,675,593		probably benign	Het
Sorcs1	C	T	19: 50,228,221	G640E	probably damaging	Het
Sync	G	A	4: 129,293,721	R182K	probably damaging	Het
Syne2	G	A	12: 76,098,034	G1586S	probably damaging	Het
Sytl1	G	T	4: 133,253,457	T522K	probably damaging	Het
Tex2	T	A	11: 106,519,955	K414*	probably null	Het
Thegl	G	T	5: 77,016,305	E52*	probably null	Het
Thsd7a	G	A	6: 12,503,916	T413I	probably benign	Het
Tm9sf1	C	T	14: 55,637,935	A451T	possibly damaging	Het
Ttn	A	T	2: 76,826,152		probably benign	Het
Uba2	T	C	7: 34,154,629	I140V	possibly damaging	Het
Ushbp1	C	A	8: 71,390,118	G361*	probably null	Het
Wbp2nl	C	T	15: 82,313,787	A175V	probably benign	Het
Zc3h12d	A	G	10: 7,862,566	E212G	probably damaging	Het
Zc3h7b	T	C	15: 81,768,830		probably benign	Het

Other mutations in Sptan1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00668:Sptan1	APN	2	29993956	critical splice donor site	probably null
IGL00932:Sptan1	APN	2	30015610	missense	probably damaging	1.00
IGL00945:Sptan1	APN	2	30000071	splice site	probably benign
IGL01070:Sptan1	APN	2	30014173	critical splice donor site	probably null
IGL01625:Sptan1	APN	2	30026114	missense	probably damaging	1.00
IGL01657:Sptan1	APN	2	30018479	missense	probably benign	0.12
IGL01795:Sptan1	APN	2	30018489	missense	probably benign	0.07
IGL01982:Sptan1	APN	2	30019968	missense	probably damaging	1.00
IGL02040:Sptan1	APN	2	30013713	missense	probably benign	0.43
IGL02158:Sptan1	APN	2	30030324	missense	probably damaging	0.97
IGL02370:Sptan1	APN	2	30030740	missense	probably damaging	0.99
IGL02507:Sptan1	APN	2	30016055	missense	probably damaging	1.00
IGL02552:Sptan1	APN	2	30018474	missense	probably damaging	0.99
IGL02690:Sptan1	APN	2	29998183	missense	possibly damaging	0.78
IGL02715:Sptan1	APN	2	29978576	missense	probably benign	0.03
IGL02725:Sptan1	APN	2	29996043	missense	probably damaging	0.99
IGL03033:Sptan1	APN	2	29991033	missense	probably damaging	1.00
IGL03304:Sptan1	APN	2	29986493	missense	probably damaging	1.00
IGL03405:Sptan1	APN	2	30025581	missense	probably damaging	0.99
R0058:Sptan1	UTSW	2	29993696	splice site	probably null
R0058:Sptan1	UTSW	2	29993696	splice site	probably null
R0066:Sptan1	UTSW	2	30003667	splice site	probably benign
R0066:Sptan1	UTSW	2	30003667	splice site	probably benign
R0071:Sptan1	UTSW	2	30003342	nonsense	probably null
R0071:Sptan1	UTSW	2	30003342	nonsense	probably null
R0094:Sptan1	UTSW	2	30006623	missense	probably benign	0.37
R0230:Sptan1	UTSW	2	30010692	splice site	probably benign
R0242:Sptan1	UTSW	2	30018401	missense	probably benign	0.00
R0366:Sptan1	UTSW	2	29992752	splice site	probably null
R0368:Sptan1	UTSW	2	29993915	missense	probably benign	0.29
R0396:Sptan1	UTSW	2	29991033	missense	probably damaging	1.00
R0423:Sptan1	UTSW	2	30028672	missense	probably null
R0448:Sptan1	UTSW	2	30026810	missense	probably damaging	1.00
R0485:Sptan1	UTSW	2	30013848	splice site	probably benign
R0580:Sptan1	UTSW	2	30007575	missense	probably damaging	0.99
R0739:Sptan1	UTSW	2	30013518	missense	probably damaging	1.00
R0924:Sptan1	UTSW	2	30016028	missense	probably damaging	0.98
R0930:Sptan1	UTSW	2	30016028	missense	probably damaging	0.98
R0961:Sptan1	UTSW	2	29980063	splice site	probably null
R1352:Sptan1	UTSW	2	30021187	splice site	probably benign
R1456:Sptan1	UTSW	2	29980203	critical splice donor site	probably null
R1537:Sptan1	UTSW	2	30026022	missense	possibly damaging	0.95
R1542:Sptan1	UTSW	2	30027127	missense	probably damaging	1.00
R1612:Sptan1	UTSW	2	30003336	missense	probably damaging	1.00
R1623:Sptan1	UTSW	2	29986420	missense	probably damaging	0.96
R1834:Sptan1	UTSW	2	29992001	splice site	probably benign
R1879:Sptan1	UTSW	2	29995528	missense	probably damaging	1.00
R1893:Sptan1	UTSW	2	30020460	missense	probably damaging	0.98
R1914:Sptan1	UTSW	2	30011036	missense	probably benign	0.00
R1915:Sptan1	UTSW	2	30011036	missense	probably benign	0.00
R2022:Sptan1	UTSW	2	30007561	missense	probably damaging	0.96
R2050:Sptan1	UTSW	2	30002238	missense	probably benign
R2103:Sptan1	UTSW	2	30030471	missense	probably damaging	1.00
R2162:Sptan1	UTSW	2	30018576	splice site	probably benign
R2931:Sptan1	UTSW	2	30018488	missense	probably benign
R3726:Sptan1	UTSW	2	30018419	missense	possibly damaging	0.59
R4170:Sptan1	UTSW	2	30030025	missense	possibly damaging	0.93
R4235:Sptan1	UTSW	2	30026588	missense	probably damaging	1.00
R4378:Sptan1	UTSW	2	30025569	missense	probably damaging	1.00
R4424:Sptan1	UTSW	2	30029709	intron	probably benign
R4718:Sptan1	UTSW	2	30031062	missense	probably damaging	1.00
R4777:Sptan1	UTSW	2	29996435	missense	probably damaging	0.98
R4849:Sptan1	UTSW	2	30011042	missense	probably damaging	1.00
R5158:Sptan1	UTSW	2	29978443	missense	probably damaging	1.00
R5180:Sptan1	UTSW	2	29993724	intron	probably benign
R5181:Sptan1	UTSW	2	29993724	intron	probably benign
R5383:Sptan1	UTSW	2	30011328	missense	probably damaging	1.00
R5573:Sptan1	UTSW	2	29986492	nonsense	probably null
R5592:Sptan1	UTSW	2	29986719	intron	probably benign
R5639:Sptan1	UTSW	2	29990993	nonsense	probably null
R5801:Sptan1	UTSW	2	30030601	splice site	probably null
R5947:Sptan1	UTSW	2	29994367	critical splice donor site	probably null
R6056:Sptan1	UTSW	2	29996782	missense	probably benign	0.36
R6090:Sptan1	UTSW	2	29993887	missense	probably damaging	1.00
R6146:Sptan1	UTSW	2	30004523	missense	probably benign	0.01
R6254:Sptan1	UTSW	2	30007549	missense	possibly damaging	0.93
R6366:Sptan1	UTSW	2	30020455	missense	possibly damaging	0.47
R6378:Sptan1	UTSW	2	30018515	missense	probably damaging	1.00
R6521:Sptan1	UTSW	2	30020455	missense	possibly damaging	0.47
R6877:Sptan1	UTSW	2	30030973	missense	probably damaging	0.99
R7173:Sptan1	UTSW	2	29983209	missense	probably benign	0.02
R7248:Sptan1	UTSW	2	30002299	missense	probably benign	0.10
R7282:Sptan1	UTSW	2	29986929	missense	probably damaging	1.00
R7527:Sptan1	UTSW	2	29980197	missense	probably damaging	1.00
R7585:Sptan1	UTSW	2	30000056	missense	probably benign	0.06
R7779:Sptan1	UTSW	2	30021307	missense	probably damaging	1.00
R8051:Sptan1	UTSW	2	30030159	missense	probably damaging	1.00
R8055:Sptan1	UTSW	2	29994339	missense	probably benign	0.22
R8103:Sptan1	UTSW	2	30020043	missense	probably damaging	1.00
R8283:Sptan1	UTSW	2	29980200	missense	probably damaging	1.00
R8507:Sptan1	UTSW	2	30026584	missense	probably damaging	1.00
R8963:Sptan1	UTSW	2	29983732	missense	possibly damaging	0.92
R9126:Sptan1	UTSW	2	30030585	missense	probably damaging	0.99
R9206:Sptan1	UTSW	2	30030712	missense	possibly damaging	0.90
R9273:Sptan1	UTSW	2	29990965	missense	possibly damaging	0.88
X0028:Sptan1	UTSW	2	30020030	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTGCTCATGTCCGTGATGACAG -3'
(R):5'- TCGGGATGCAAAAGGTAGGGCTTC -3'

Sequencing Primer
(F):5'- TGTCCGTGATGACAGGTACTAAG -3'
(R):5'- CCTGTGACATGATGGTTAAAGCAC -3'

Posted On

2013-07-11