Incidental Mutation 'R7721:Cldn23'
ID595225
Institutional Source Beutler Lab
Gene Symbol Cldn23
Ensembl Gene ENSMUSG00000055976
Gene Nameclaudin 23
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R7721 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location35824712-35826559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 35826263 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 24 (S24R)
Ref Sequence ENSEMBL: ENSMUSP00000049725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060128]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060128
AA Change: S24R

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049725
Gene: ENSMUSG00000055976
AA Change: S24R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 177 6e-19 PFAM
low complexity region 273 284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210370
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is intronless and the protein encoded by this gene is 77% identical to the human homolog. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik C T 9: 36,637,863 G34R possibly damaging Het
Acad10 T C 5: 121,646,866 probably null Het
Adamtsl3 T G 7: 82,606,520 M1580R possibly damaging Het
Alg9 T C 9: 50,776,642 I78T probably damaging Het
Ankmy2 G T 12: 36,157,144 probably benign Het
Ankrd11 G T 8: 122,894,759 L785M probably damaging Het
Atrnl1 T A 19: 57,696,331 D796E probably benign Het
C1s2 A G 6: 124,630,058 V277A possibly damaging Het
Cldn15 A G 5: 136,968,161 M19V probably benign Het
Cnr1 T A 4: 33,944,416 I268N probably damaging Het
Csf2ra A T 19: 61,226,586 W147R probably damaging Het
Ctsb G T 14: 63,133,316 probably benign Het
D430041D05Rik A G 2: 104,258,529 M34T probably benign Het
Dmtf1 T C 5: 9,126,564 I463V probably damaging Het
Dnah7a T A 1: 53,631,683 D470V probably benign Het
Dtx4 A G 19: 12,482,136 S435P probably benign Het
Ear2 T A 14: 44,103,038 M51K probably damaging Het
Elmo1 T A 13: 20,280,803 probably null Het
Faf1 T A 4: 109,736,597 I124N probably damaging Het
Gkap1 A C 13: 58,236,985 probably null Het
Glipr2 T C 4: 43,957,770 S4P probably benign Het
Gm11639 T A 11: 104,724,540 L711* probably null Het
Gm38119 A T 3: 92,738,030 C86S unknown Het
Gm6583 A G 5: 112,355,517 I107T probably benign Het
Gpr171 T G 3: 59,097,899 I152L probably benign Het
Hes7 T A 11: 69,121,526 T9S unknown Het
Homer3 T C 8: 70,291,012 V180A probably benign Het
Irx1 T A 13: 71,960,057 M169L probably benign Het
Kap A G 6: 133,851,727 probably null Het
Mgat5b A G 11: 116,966,801 M2V Het
Mob4 C T 1: 55,148,320 Q76* probably null Het
Olfr1493-ps1 T A 19: 13,726,843 I194N possibly damaging Het
Olfr911-ps1 A T 9: 38,523,717 probably null Het
Olfr943 A G 9: 39,184,760 D191G probably benign Het
Pcdha9 A T 18: 36,999,636 Q586L probably benign Het
Pgk2 T A 17: 40,207,518 I340F probably benign Het
Prex1 G A 2: 166,577,890 Q1289* probably null Het
Prr22 A G 17: 56,771,819 D324G possibly damaging Het
Rab2b A T 14: 52,263,760 S201T probably benign Het
Rdh1 T A 10: 127,760,252 probably null Het
Rhbdl1 G T 17: 25,836,149 N82K probably benign Het
Rspo1 C A 4: 124,991,417 Q29K possibly damaging Het
Rtp3 A T 9: 110,985,880 Y472* probably null Het
Senp5 T A 16: 31,990,434 M1L unknown Het
Slfn4 A T 11: 83,187,563 probably null Het
Stab1 A G 14: 31,141,456 V2091A possibly damaging Het
Stk32c A G 7: 139,188,153 S71P possibly damaging Het
Tpr A G 1: 150,444,429 T2243A probably benign Het
Tubgcp6 A T 15: 89,101,401 N1544K probably damaging Het
Uqcc1 T C 2: 155,858,146 N202S probably benign Het
Vmn2r18 C T 5: 151,586,693 E72K possibly damaging Het
Zfp654 C A 16: 64,786,207 C3F probably damaging Het
Zfp804b T C 5: 6,771,263 E600G possibly damaging Het
Other mutations in Cldn23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Cldn23 APN 8 35825920 missense possibly damaging 0.81
IGL01767:Cldn23 APN 8 35825662 missense probably damaging 1.00
IGL02078:Cldn23 APN 8 35826205 missense possibly damaging 0.94
IGL03346:Cldn23 APN 8 35825440 intron probably benign
R1610:Cldn23 UTSW 8 35825930 missense probably damaging 1.00
R1753:Cldn23 UTSW 8 35825986 missense possibly damaging 0.94
R1915:Cldn23 UTSW 8 35825945 missense possibly damaging 0.69
R2121:Cldn23 UTSW 8 35826235 missense probably benign
R4342:Cldn23 UTSW 8 35825498 missense probably benign 0.00
R5167:Cldn23 UTSW 8 35826320 missense possibly damaging 0.89
R5207:Cldn23 UTSW 8 35826028 missense probably damaging 1.00
R6102:Cldn23 UTSW 8 35825551 missense probably benign 0.00
R7106:Cldn23 UTSW 8 35825915 missense probably benign
R7363:Cldn23 UTSW 8 35825505 critical splice donor site probably null
R8119:Cldn23 UTSW 8 35825902 missense probably damaging 0.99
Z1176:Cldn23 UTSW 8 35826277 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGACGTGATCATGAGTCCCC -3'
(R):5'- ACTTGGTGTGAGAGGCTCAG -3'

Sequencing Primer
(F):5'- ATCATGAGTCCCCGGGCC -3'
(R):5'- AGGCTCAGTGGGGACAGTTC -3'
Posted On2019-11-12