Incidental Mutation 'R7721:Rtp3'
ID595232
Institutional Source Beutler Lab
Gene Symbol Rtp3
Ensembl Gene ENSMUSG00000066319
Gene Namereceptor transporter protein 3
SynonymsTmem7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7721 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location110984935-110990583 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 110985880 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 472 (Y472*)
Ref Sequence ENSEMBL: ENSMUSP00000081985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035076] [ENSMUST00000084922] [ENSMUST00000198702] [ENSMUST00000199891]
Predicted Effect probably benign
Transcript: ENSMUST00000035076
SMART Domains Protein: ENSMUSP00000035076
Gene: ENSMUSG00000032495

DomainStartEndE-ValueType
Blast:LRR 143 165 5e-7 BLAST
LRR_TYP 166 189 4.87e-4 SMART
LRR 236 258 1.41e1 SMART
LRR 259 282 2.27e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000084922
AA Change: Y472*
SMART Domains Protein: ENSMUSP00000081985
Gene: ENSMUSG00000066319
AA Change: Y472*

DomainStartEndE-ValueType
zf-3CxxC 52 164 2.13e-52 SMART
low complexity region 356 404 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198702
SMART Domains Protein: ENSMUSP00000143100
Gene: ENSMUSG00000066319

DomainStartEndE-ValueType
Pfam:zf-3CxxC 52 81 2.5e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000199891
AA Change: Y472*
SMART Domains Protein: ENSMUSP00000143305
Gene: ENSMUSG00000066319
AA Change: Y472*

DomainStartEndE-ValueType
zf-3CxxC 52 164 2.13e-52 SMART
low complexity region 356 404 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik T A 11: 69,121,526 T9S unknown Het
A630095E13Rik C T 9: 36,637,863 G34R possibly damaging Het
Adamtsl3 T G 7: 82,606,520 M1580R possibly damaging Het
Alg9 T C 9: 50,776,642 I78T probably damaging Het
Ankrd11 G T 8: 122,894,759 L785M probably damaging Het
Atrnl1 T A 19: 57,696,331 D796E probably benign Het
C1s2 A G 6: 124,630,058 V277A possibly damaging Het
Cldn15 A G 5: 136,968,161 M19V probably benign Het
Cldn23 T G 8: 35,826,263 S24R possibly damaging Het
Cnr1 T A 4: 33,944,416 I268N probably damaging Het
Csf2ra A T 19: 61,226,586 W147R probably damaging Het
Ctsb G T 14: 63,133,316 probably benign Het
D430041D05Rik A G 2: 104,258,529 M34T probably benign Het
Dmtf1 T C 5: 9,126,564 I463V probably damaging Het
Dnah7a T A 1: 53,631,683 D470V probably benign Het
Dtx4 A G 19: 12,482,136 S435P probably benign Het
Ear2 T A 14: 44,103,038 M51K probably damaging Het
Faf1 T A 4: 109,736,597 I124N probably damaging Het
Gkap1 A C 13: 58,236,985 probably null Het
Glipr2 T C 4: 43,957,770 S4P probably benign Het
Gm11639 T A 11: 104,724,540 L711* probably null Het
Gm38119 A T 3: 92,738,030 C86S unknown Het
Gm6583 A G 5: 112,355,517 I107T probably benign Het
Gpr171 T G 3: 59,097,899 I152L probably benign Het
Homer3 T C 8: 70,291,012 V180A probably benign Het
Irx1 T A 13: 71,960,057 M169L probably benign Het
Kap A G 6: 133,851,727 probably null Het
Lyzl4 GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAAGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG 9: 121,583,989 probably null Het
Mgat5b A G 11: 116,966,801 M2V Het
Mob4 C T 1: 55,148,320 Q76* probably null Het
Olfr1493-ps1 T A 19: 13,726,843 I194N possibly damaging Het
Olfr911-ps1 A T 9: 38,523,717 probably null Het
Olfr943 A G 9: 39,184,760 D191G probably benign Het
Pcdha9 A T 18: 36,999,636 Q586L probably benign Het
Pgk2 T A 17: 40,207,518 I340F probably benign Het
Prex1 G A 2: 166,577,890 Q1289* probably null Het
Prr22 A G 17: 56,771,819 D324G possibly damaging Het
Rab2b A T 14: 52,263,760 S201T probably benign Het
Rdh1 T A 10: 127,760,252 probably null Het
Rhbdl1 G T 17: 25,836,149 N82K probably benign Het
Rspo1 C A 4: 124,991,417 Q29K possibly damaging Het
Senp5 T A 16: 31,990,434 M1L unknown Het
Stab1 A G 14: 31,141,456 V2091A possibly damaging Het
Stk32c A G 7: 139,188,153 S71P possibly damaging Het
Tpr A G 1: 150,444,429 T2243A probably benign Het
Tubgcp6 A T 15: 89,101,401 N1544K probably damaging Het
Uqcc1 T C 2: 155,858,146 N202S probably benign Het
Vmn2r18 C T 5: 151,586,693 E72K possibly damaging Het
Zfp654 C A 16: 64,786,207 C3F probably damaging Het
Zfp804b T C 5: 6,771,263 E600G possibly damaging Het
Other mutations in Rtp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Rtp3 APN 9 110986598 missense probably benign 0.03
IGL02212:Rtp3 APN 9 110987321 splice site probably benign
IGL03033:Rtp3 APN 9 110986094 unclassified probably benign
R0392:Rtp3 UTSW 9 110989553 missense probably damaging 0.98
R0529:Rtp3 UTSW 9 110987084 missense possibly damaging 0.93
R0645:Rtp3 UTSW 9 110987100 missense probably damaging 0.97
R1282:Rtp3 UTSW 9 110986920 missense probably benign 0.01
R1609:Rtp3 UTSW 9 110986017 unclassified probably benign
R1649:Rtp3 UTSW 9 110986704 missense probably benign 0.00
R1662:Rtp3 UTSW 9 110986683 missense probably benign 0.23
R2011:Rtp3 UTSW 9 110986034 unclassified probably benign
R3697:Rtp3 UTSW 9 110987194 missense possibly damaging 0.86
R4661:Rtp3 UTSW 9 110986451 unclassified probably null
R4707:Rtp3 UTSW 9 110986211 unclassified probably benign
R4764:Rtp3 UTSW 9 110987350 intron probably benign
R4796:Rtp3 UTSW 9 110986454 missense probably benign 0.00
R4839:Rtp3 UTSW 9 110989476 missense probably damaging 1.00
R5262:Rtp3 UTSW 9 110986127 unclassified probably benign
R5886:Rtp3 UTSW 9 110987136 missense probably damaging 1.00
R5932:Rtp3 UTSW 9 110986692 missense probably benign 0.04
R6089:Rtp3 UTSW 9 110986973 missense probably benign 0.00
R6545:Rtp3 UTSW 9 110986826 missense possibly damaging 0.83
R6812:Rtp3 UTSW 9 110987112 missense probably benign 0.14
R6895:Rtp3 UTSW 9 110987196 missense possibly damaging 0.72
R7023:Rtp3 UTSW 9 110986646 missense probably benign 0.00
R7113:Rtp3 UTSW 9 110986699 missense probably damaging 0.98
R7167:Rtp3 UTSW 9 110986704 missense probably benign 0.01
R7171:Rtp3 UTSW 9 110985941 missense unknown
R7359:Rtp3 UTSW 9 110986296 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CACATTGCTTAAACCGTGGC -3'
(R):5'- TCGTGGAGACTACCAGAAAAC -3'

Sequencing Primer
(F):5'- TGCTTAAACCGTGGCTTTTATAC -3'
(R):5'- CACTATTTGCCAAGTAGAGAGAAAC -3'
Posted On2019-11-12