Incidental Mutation 'R7721:Rdh1'
ID 595234
Institutional Source Beutler Lab
Gene Symbol Rdh1
Ensembl Gene ENSMUSG00000089789
Gene Name retinol dehydrogenase 1 (all trans)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R7721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 127759721-127768297 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 127760252 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073639] [ENSMUST00000128247]
AlphaFold Q8CGV4
Predicted Effect probably null
Transcript: ENSMUST00000073639
SMART Domains Protein: ENSMUSP00000073322
Gene: ENSMUSG00000089789

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:adh_short 30 222 5.7e-43 PFAM
Pfam:DUF1776 43 303 3.3e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128247
SMART Domains Protein: ENSMUSP00000116574
Gene: ENSMUSG00000099009

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:adh_short 30 195 1.7e-23 PFAM
Pfam:DUF1776 43 303 3.3e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased body weight, adipose tissue, and retinol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik C T 9: 36,637,863 G34R possibly damaging Het
Acad10 T C 5: 121,646,866 probably null Het
Adamtsl3 T G 7: 82,606,520 M1580R possibly damaging Het
Alg9 T C 9: 50,776,642 I78T probably damaging Het
Ankmy2 G T 12: 36,157,144 probably benign Het
Ankrd11 G T 8: 122,894,759 L785M probably damaging Het
Atrnl1 T A 19: 57,696,331 D796E probably benign Het
C1s2 A G 6: 124,630,058 V277A possibly damaging Het
Cldn15 A G 5: 136,968,161 M19V probably benign Het
Cldn23 T G 8: 35,826,263 S24R possibly damaging Het
Cnr1 T A 4: 33,944,416 I268N probably damaging Het
Csf2ra A T 19: 61,226,586 W147R probably damaging Het
Ctsb G T 14: 63,133,316 probably benign Het
D430041D05Rik A G 2: 104,258,529 M34T probably benign Het
Dmtf1 T C 5: 9,126,564 I463V probably damaging Het
Dnah7a T A 1: 53,631,683 D470V probably benign Het
Dtx4 A G 19: 12,482,136 S435P probably benign Het
Ear2 T A 14: 44,103,038 M51K probably damaging Het
Elmo1 T A 13: 20,280,803 probably null Het
Faf1 T A 4: 109,736,597 I124N probably damaging Het
Gkap1 A C 13: 58,236,985 probably null Het
Glipr2 T C 4: 43,957,770 S4P probably benign Het
Gm11639 T A 11: 104,724,540 L711* probably null Het
Gm38119 A T 3: 92,738,030 C86S unknown Het
Gm6583 A G 5: 112,355,517 I107T probably benign Het
Gpr171 T G 3: 59,097,899 I152L probably benign Het
Hes7 T A 11: 69,121,526 T9S unknown Het
Homer3 T C 8: 70,291,012 V180A probably benign Het
Irx1 T A 13: 71,960,057 M169L probably benign Het
Kap A G 6: 133,851,727 probably null Het
Mgat5b A G 11: 116,966,801 M2V Het
Mob4 C T 1: 55,148,320 Q76* probably null Het
Olfr1493-ps1 T A 19: 13,726,843 I194N possibly damaging Het
Olfr911-ps1 A T 9: 38,523,717 probably null Het
Olfr943 A G 9: 39,184,760 D191G probably benign Het
Pcdha9 A T 18: 36,999,636 Q586L probably benign Het
Pgk2 T A 17: 40,207,518 I340F probably benign Het
Prex1 G A 2: 166,577,890 Q1289* probably null Het
Prr22 A G 17: 56,771,819 D324G possibly damaging Het
Rab2b A T 14: 52,263,760 S201T probably benign Het
Rhbdl1 G T 17: 25,836,149 N82K probably benign Het
Rspo1 C A 4: 124,991,417 Q29K possibly damaging Het
Rtp3 A T 9: 110,985,880 Y472* probably null Het
Senp5 T A 16: 31,990,434 M1L unknown Het
Slfn4 A T 11: 83,187,563 probably null Het
Stab1 A G 14: 31,141,456 V2091A possibly damaging Het
Stk32c A G 7: 139,188,153 S71P possibly damaging Het
Tpr A G 1: 150,444,429 T2243A probably benign Het
Tubgcp6 A T 15: 89,101,401 N1544K probably damaging Het
Uqcc1 T C 2: 155,858,146 N202S probably benign Het
Vmn2r18 C T 5: 151,586,693 E72K possibly damaging Het
Zfp654 C A 16: 64,786,207 C3F probably damaging Het
Zfp804b T C 5: 6,771,263 E600G possibly damaging Het
Other mutations in Rdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02745:Rdh1 APN 10 127765419 missense probably benign 0.06
R0077:Rdh1 UTSW 10 127760037 missense probably damaging 1.00
R0481:Rdh1 UTSW 10 127763124 missense probably damaging 1.00
R0511:Rdh1 UTSW 10 127764783 missense probably benign
R0558:Rdh1 UTSW 10 127759941 missense possibly damaging 0.88
R1569:Rdh1 UTSW 10 127763072 missense probably benign
R1993:Rdh1 UTSW 10 127765345 missense probably benign
R2164:Rdh1 UTSW 10 127760172 missense possibly damaging 0.89
R3021:Rdh1 UTSW 10 127760208 missense possibly damaging 0.91
R5268:Rdh1 UTSW 10 127759963 missense possibly damaging 0.67
R6126:Rdh1 UTSW 10 127763214 missense probably damaging 1.00
R6216:Rdh1 UTSW 10 127764753 missense probably benign 0.00
R7017:Rdh1 UTSW 10 127763037 missense probably benign 0.02
R7332:Rdh1 UTSW 10 127759885 start gained probably benign
R7397:Rdh1 UTSW 10 127760178 missense probably benign 0.24
R7724:Rdh1 UTSW 10 127764707 missense possibly damaging 0.46
R7873:Rdh1 UTSW 10 127760023 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGACTCTGGCTTTGGGAAC -3'
(R):5'- GGCACCTTCTTACCAAGACC -3'

Sequencing Primer
(F):5'- AACCTGCTGGCCAGACAG -3'
(R):5'- TTCTTACCAAGACCAGAGCACTTGG -3'
Posted On 2019-11-12