Incidental Mutation 'R7721:Mgat5b'
ID595237
Institutional Source Beutler Lab
Gene Symbol Mgat5b
Ensembl Gene ENSMUSG00000043857
Gene Namemannoside acetylglucosaminyltransferase 5, isoenzyme B
SynonymsGnT-IX
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R7721 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116918863-116986948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116966801 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 2 (M2V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103027]
Predicted Effect probably benign
Transcript: ENSMUST00000103027
AA Change: M374V

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099316
Gene: ENSMUSG00000043857
AA Change: M374V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Glyco_transf_18 184 777 3.5e-269 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122276
Gene: ENSMUSG00000043857
AA Change: M2V

DomainStartEndE-ValueType
Pfam:Glyco_transf_18 1 214 3e-116 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The MGAT5B gene encodes a beta-1,6-N-acetylglucosaminyltransferase (EC 2.4.1.155) that functions in the synthesis of complex cell surface N-glycans (Kaneko et al., 2003 [PubMed 14623122]).[supplied by OMIM, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit low levels of O-man-linked beta1,6-branched glycans. Mice homozygous for a different knock-out allele exhibit decreased susceptibility to cuprizone induced injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik C T 9: 36,637,863 G34R possibly damaging Het
Acad10 T C 5: 121,646,866 probably null Het
Adamtsl3 T G 7: 82,606,520 M1580R possibly damaging Het
Alg9 T C 9: 50,776,642 I78T probably damaging Het
Ankmy2 G T 12: 36,157,144 probably benign Het
Ankrd11 G T 8: 122,894,759 L785M probably damaging Het
Atrnl1 T A 19: 57,696,331 D796E probably benign Het
C1s2 A G 6: 124,630,058 V277A possibly damaging Het
Cldn15 A G 5: 136,968,161 M19V probably benign Het
Cldn23 T G 8: 35,826,263 S24R possibly damaging Het
Cnr1 T A 4: 33,944,416 I268N probably damaging Het
Csf2ra A T 19: 61,226,586 W147R probably damaging Het
Ctsb G T 14: 63,133,316 probably benign Het
D430041D05Rik A G 2: 104,258,529 M34T probably benign Het
Dmtf1 T C 5: 9,126,564 I463V probably damaging Het
Dnah7a T A 1: 53,631,683 D470V probably benign Het
Dtx4 A G 19: 12,482,136 S435P probably benign Het
Ear2 T A 14: 44,103,038 M51K probably damaging Het
Elmo1 T A 13: 20,280,803 probably null Het
Faf1 T A 4: 109,736,597 I124N probably damaging Het
Gkap1 A C 13: 58,236,985 probably null Het
Glipr2 T C 4: 43,957,770 S4P probably benign Het
Gm11639 T A 11: 104,724,540 L711* probably null Het
Gm38119 A T 3: 92,738,030 C86S unknown Het
Gm6583 A G 5: 112,355,517 I107T probably benign Het
Gpr171 T G 3: 59,097,899 I152L probably benign Het
Hes7 T A 11: 69,121,526 T9S unknown Het
Homer3 T C 8: 70,291,012 V180A probably benign Het
Irx1 T A 13: 71,960,057 M169L probably benign Het
Kap A G 6: 133,851,727 probably null Het
Mob4 C T 1: 55,148,320 Q76* probably null Het
Olfr1493-ps1 T A 19: 13,726,843 I194N possibly damaging Het
Olfr911-ps1 A T 9: 38,523,717 probably null Het
Olfr943 A G 9: 39,184,760 D191G probably benign Het
Pcdha9 A T 18: 36,999,636 Q586L probably benign Het
Pgk2 T A 17: 40,207,518 I340F probably benign Het
Prex1 G A 2: 166,577,890 Q1289* probably null Het
Prr22 A G 17: 56,771,819 D324G possibly damaging Het
Rab2b A T 14: 52,263,760 S201T probably benign Het
Rdh1 T A 10: 127,760,252 probably null Het
Rhbdl1 G T 17: 25,836,149 N82K probably benign Het
Rspo1 C A 4: 124,991,417 Q29K possibly damaging Het
Rtp3 A T 9: 110,985,880 Y472* probably null Het
Senp5 T A 16: 31,990,434 M1L unknown Het
Slfn4 A T 11: 83,187,563 probably null Het
Stab1 A G 14: 31,141,456 V2091A possibly damaging Het
Stk32c A G 7: 139,188,153 S71P possibly damaging Het
Tpr A G 1: 150,444,429 T2243A probably benign Het
Tubgcp6 A T 15: 89,101,401 N1544K probably damaging Het
Uqcc1 T C 2: 155,858,146 N202S probably benign Het
Vmn2r18 C T 5: 151,586,693 E72K possibly damaging Het
Zfp654 C A 16: 64,786,207 C3F probably damaging Het
Zfp804b T C 5: 6,771,263 E600G possibly damaging Het
Other mutations in Mgat5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Mgat5b APN 11 116931662 missense probably damaging 0.99
IGL01315:Mgat5b APN 11 116923389 missense probably damaging 1.00
IGL01432:Mgat5b APN 11 116973376 missense probably benign
IGL01480:Mgat5b APN 11 116978452 missense probably benign 0.00
IGL02573:Mgat5b APN 11 116977714 missense probably benign 0.01
IGL02627:Mgat5b APN 11 116983616 missense probably damaging 1.00
IGL03053:Mgat5b APN 11 116923450 missense possibly damaging 0.94
R0149:Mgat5b UTSW 11 116985139 splice site probably benign
R1175:Mgat5b UTSW 11 116977796 missense probably damaging 1.00
R1242:Mgat5b UTSW 11 116978404 missense probably benign 0.08
R1341:Mgat5b UTSW 11 116978397 missense probably benign 0.38
R1666:Mgat5b UTSW 11 116983648 missense probably benign 0.01
R1667:Mgat5b UTSW 11 116947377 missense probably benign 0.00
R1668:Mgat5b UTSW 11 116983648 missense probably benign 0.01
R1702:Mgat5b UTSW 11 116948659 missense possibly damaging 0.73
R1828:Mgat5b UTSW 11 116977788 missense probably damaging 1.00
R2019:Mgat5b UTSW 11 116947348 missense probably benign 0.07
R2102:Mgat5b UTSW 11 116919429 start gained probably benign
R2382:Mgat5b UTSW 11 116919496 missense probably damaging 0.99
R4995:Mgat5b UTSW 11 116974199 critical splice donor site probably null
R5028:Mgat5b UTSW 11 116985029 missense probably damaging 1.00
R5174:Mgat5b UTSW 11 116977715 missense probably benign 0.01
R5403:Mgat5b UTSW 11 116948657 missense probably benign 0.35
R5643:Mgat5b UTSW 11 116973400 missense probably damaging 0.99
R5644:Mgat5b UTSW 11 116973400 missense probably damaging 0.99
R7116:Mgat5b UTSW 11 116944959 missense possibly damaging 0.93
R7238:Mgat5b UTSW 11 116984983 missense probably benign 0.09
R7284:Mgat5b UTSW 11 116944920 missense probably damaging 0.96
R7440:Mgat5b UTSW 11 116968445 nonsense probably null
R8179:Mgat5b UTSW 11 116931728 missense probably benign 0.01
R8229:Mgat5b UTSW 11 116947387 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGATTCATCTCTGAGAGTGGC -3'
(R):5'- CTGTGGTCCCAGTAATTCCTG -3'

Sequencing Primer
(F):5'- GGCTCTCACTGCCCCGC -3'
(R):5'- CAGTAATTCCTGGTTCTGGGTCTAC -3'
Posted On2019-11-12