Mutagenetix > Incidental Mutation

Incidental Mutation 'R0242:Lrp1b'

59524

Institutional Source

Beutler Lab

Gene Symbol

Lrp1b

Ensembl Gene

ENSMUSG00000049252

Gene Name

low density lipoprotein-related protein 1B (deleted in tumors)

Synonyms

9630004P12Rik

MMRRC Submission

038480-MU

Accession Numbers

Genbank: NM_053011.2

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0242 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40595246-42653624 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 40998183 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 2355 (H2355L)

Ref Sequence

ENSEMBL: ENSMUSP00000054275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052550] [ENSMUST00000167270]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000052550
AA Change: H2355L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000054275
Gene: ENSMUSG00000049252
AA Change: H2355L

Domain	Start	End	E-Value	Type
low complexity region	3	19	N/A	INTRINSIC
low complexity region	35	46	N/A	INTRINSIC
LDLa	62	102	2.97e-12	SMART
LDLa	107	146	1.31e-8	SMART
EGF	150	185	1.95e1	SMART
EGF_CA	186	225	8.37e-8	SMART
LY	256	300	4.06e1	SMART
LY	304	348	1.15e-5	SMART
LY	349	392	1.17e-11	SMART
LY	393	435	1.12e-8	SMART
LY	436	478	2.21e1	SMART
EGF	505	548	2.45e0	SMART
LY	579	621	1.32e-5	SMART
LY	622	665	1.88e-10	SMART
LY	668	717	1.47e-12	SMART
LY	718	760	5.78e-11	SMART
LY	761	802	1.45e0	SMART
EGF_like	828	865	4.55e1	SMART
LDLa	875	914	7.15e-15	SMART
LDLa	916	955	5.26e-13	SMART
LDLa	957	995	6.13e-14	SMART
LDLa	997	1035	6.47e-13	SMART
LDLa	1036	1075	1.76e-14	SMART
LDLa	1083	1121	2.29e-13	SMART
LDLa	1125	1164	3.36e-11	SMART
LDLa	1166	1206	2.57e-7	SMART
EGF	1206	1244	1.58e-3	SMART
EGF	1248	1284	4.56e0	SMART
LY	1311	1353	4.85e-4	SMART
LY	1358	1400	6.49e-14	SMART
LY	1401	1445	8.18e-11	SMART
LY	1446	1490	4.25e-9	SMART
LY	1492	1534	5.4e-2	SMART
EGF	1561	1601	9.41e-2	SMART
LY	1629	1671	3.03e-5	SMART
LY	1672	1716	1.22e-9	SMART
LY	1718	1756	1.02e-2	SMART
LY	1757	1798	8.25e-7	SMART
EGF	1868	1906	4.03e-1	SMART
LY	1933	1975	1.01e-1	SMART
LY	1976	2018	3.03e-14	SMART
LY	2019	2062	2.16e-10	SMART
LY	2063	2105	4.09e-11	SMART
LY	2107	2149	9.96e0	SMART
EGF	2177	2214	2.13e0	SMART
LY	2292	2334	6.96e-5	SMART
LY	2340	2385	1.07e-5	SMART
LY	2386	2428	1.1e-11	SMART
LY	2429	2470	4.78e-3	SMART
EGF	2498	2535	2.03e1	SMART
LDLa	2540	2580	1.1e-6	SMART
LDLa	2582	2619	1.72e-8	SMART
LDLa	2621	2658	2.45e-13	SMART
LDLa	2669	2707	6.53e-9	SMART
LDLa	2712	2749	7.97e-13	SMART
LDLa	2750	2789	1.22e-8	SMART
LDLa	2791	2832	3.07e-14	SMART
LDLa	2835	2873	7.32e-12	SMART
LDLa	2875	2917	1.85e-8	SMART
LDLa	2921	2958	4.76e-11	SMART
EGF_CA	2957	2998	1.79e-7	SMART
EGF_CA	2999	3039	1.85e-9	SMART
LY	3066	3111	2.58e-8	SMART
LY	3112	3152	1.22e-9	SMART
LY	3153	3196	8.84e-7	SMART
LY	3197	3237	3.22e-9	SMART
LY	3238	3279	1.04e-3	SMART
EGF	3307	3345	7.13e-2	SMART
LDLa	3347	3385	9.29e-14	SMART
LDLa	3387	3424	2.25e-12	SMART
LDLa	3426	3464	5.63e-13	SMART
LDLa	3466	3504	1.07e-13	SMART
LDLa	3506	3543	1.35e-15	SMART
EGF_like	3545	3581	2.8e1	SMART
LDLa	3545	3582	1.49e-12	SMART
LDLa	3583	3620	4.21e-12	SMART
LDLa	3624	3661	4.9e-13	SMART
LDLa	3662	3700	9.58e-16	SMART
LDLa	3704	3743	5.38e-10	SMART
LDLa	3745	3784	1.42e-9	SMART
LDLa	3792	3829	3.66e-12	SMART
EGF	3835	3874	3.71e0	SMART
EGF_CA	3875	3912	6.8e-8	SMART
LY	3987	4033	4.24e0	SMART
LY	4050	4093	4.46e-3	SMART
LY	4094	4136	1.73e-9	SMART
EGF	4206	4239	2.45e0	SMART
EGF	4247	4280	2.48e-1	SMART
EGF	4283	4316	1.49e-4	SMART
EGF	4319	4352	1.69e-3	SMART
EGF	4355	4388	1.18e1	SMART
EGF_like	4391	4423	6.67e1	SMART
EGF	4424	4458	1.61e0	SMART
transmembrane domain	4476	4498	N/A	INTRINSIC
low complexity region	4499	4509	N/A	INTRINSIC
low complexity region	4512	4523	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000121274

Predicted Effect

probably benign
Transcript: ENSMUST00000167270
AA Change: H2241L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129192
Gene: ENSMUSG00000049252
AA Change: H2241L

Domain	Start	End	E-Value	Type
EGF	5	40	1.95e1	SMART
EGF_CA	41	80	8.37e-8	SMART
LY	111	155	4.06e1	SMART
LY	159	203	1.15e-5	SMART
LY	204	247	1.17e-11	SMART
LY	248	290	1.12e-8	SMART
LY	291	333	2.21e1	SMART
EGF	360	403	2.45e0	SMART
LY	434	476	1.32e-5	SMART
LY	477	520	1.88e-10	SMART
LY	523	572	1.47e-12	SMART
LY	573	615	5.78e-11	SMART
LY	616	657	1.45e0	SMART
EGF_like	683	720	4.55e1	SMART
LDLa	730	769	7.15e-15	SMART
LDLa	771	810	5.26e-13	SMART
LDLa	812	850	6.13e-14	SMART
LDLa	852	890	6.47e-13	SMART
LDLa	891	930	1.76e-14	SMART
LDLa	938	976	2.29e-13	SMART
LDLa	980	1019	3.36e-11	SMART
LDLa	1021	1061	2.57e-7	SMART
EGF	1061	1099	1.58e-3	SMART
EGF	1103	1139	4.56e0	SMART
LY	1166	1208	4.85e-4	SMART
LY	1213	1255	6.49e-14	SMART
LY	1256	1300	8.18e-11	SMART
LY	1301	1345	4.25e-9	SMART
LY	1347	1389	5.4e-2	SMART
EGF	1416	1456	9.41e-2	SMART
LY	1484	1526	3.03e-5	SMART
LY	1527	1571	1.22e-9	SMART
LY	1573	1611	1.02e-2	SMART
LY	1612	1653	8.25e-7	SMART
EGF	1723	1761	4.03e-1	SMART
LY	1788	1830	1.01e-1	SMART
LY	1831	1873	3.03e-14	SMART
LY	1874	1917	2.16e-10	SMART
LY	1918	1960	4.09e-11	SMART
LY	1962	2004	9.96e0	SMART
EGF	2032	2069	2.13e0	SMART
LY	2147	2189	6.96e-5	SMART
LY	2195	2240	1.07e-5	SMART
LY	2241	2283	1.1e-11	SMART
LY	2284	2325	4.78e-3	SMART
EGF	2353	2390	2.03e1	SMART
LDLa	2395	2435	1.1e-6	SMART
LDLa	2437	2474	1.72e-8	SMART
LDLa	2476	2513	2.45e-13	SMART
LDLa	2524	2562	6.53e-9	SMART
LDLa	2567	2604	7.97e-13	SMART
LDLa	2605	2644	1.22e-8	SMART
LDLa	2646	2687	3.07e-14	SMART
LDLa	2690	2728	7.32e-12	SMART
LDLa	2730	2772	1.85e-8	SMART
LDLa	2776	2813	4.76e-11	SMART
EGF_CA	2812	2853	1.79e-7	SMART
EGF_CA	2854	2894	1.85e-9	SMART
LY	2921	2966	2.58e-8	SMART
LY	2967	3007	1.22e-9	SMART
LY	3008	3051	8.84e-7	SMART
LY	3052	3092	3.22e-9	SMART
LY	3093	3134	1.04e-3	SMART
EGF	3162	3200	7.13e-2	SMART
LDLa	3202	3240	9.29e-14	SMART
LDLa	3242	3279	2.25e-12	SMART
LDLa	3281	3319	5.63e-13	SMART
LDLa	3321	3357	5.86e-11	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.5%

Validation Efficiency

97% (110/113)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor family. These receptors play a wide variety of roles in normal cell function and development due to their interactions with multiple ligands. Disruption of this gene has been reported in several types of cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous null mice appear normal, are fertile, have normal brain histology and function, normal plasma cholesterol and fasting triglycerides, and do not develop tumors. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted, knock-out(3) Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029H14Rik	T	C	8: 13,551,676	D230G	probably benign	Het
4930435E12Rik	C	T	16: 38,824,567		probably benign	Het
Abhd13	A	G	8: 9,987,561	I53V	probably benign	Het
Adgrl2	A	C	3: 148,839,185		probably null	Het
Aldh16a1	G	A	7: 45,144,664	A596V	probably damaging	Het
Aldh3b2	T	A	19: 3,979,414	Y262*	probably null	Het
Ambn	A	G	5: 88,467,972	Q420R	possibly damaging	Het
Ankib1	A	C	5: 3,700,344		probably benign	Het
Arhgap9	C	A	10: 127,329,538	H430Q	probably benign	Het
Arhgef25	C	T	10: 127,184,064	G435E	probably damaging	Het
Armc12	A	T	17: 28,532,392	D120V	possibly damaging	Het
Armc4	A	T	18: 7,211,516	V786D	probably damaging	Het
Asxl3	G	A	18: 22,516,681	E576K	possibly damaging	Het
Bcdin3d	T	C	15: 99,470,895	E141G	probably benign	Het
Bmpr1b	G	A	3: 141,840,676	T483M	probably damaging	Het
Caprin2	C	T	6: 148,842,954	S991N	probably damaging	Het
Cd96	T	C	16: 46,071,766	I286M	possibly damaging	Het
Cdcp1	G	T	9: 123,180,172	F480L	probably benign	Het
Celf5	T	C	10: 81,464,409	T258A	probably benign	Het
Cgnl1	A	G	9: 71,721,657	V577A	probably damaging	Het
Clca3b	A	G	3: 144,841,465	S304P	probably benign	Het
Cmya5	A	T	13: 93,095,600	H993Q	probably benign	Het
Cnbp	A	T	6: 87,845,764	C6S	probably damaging	Het
Col14a1	C	T	15: 55,497,511	R1605W	probably damaging	Het
Cops7a	T	C	6: 124,964,854	N11S	probably benign	Het
Coro7	T	C	16: 4,630,178		probably benign	Het
Cpvl	T	C	6: 53,932,500	H217R	possibly damaging	Het
Cuedc1	T	C	11: 88,184,621		probably benign	Het
Cyp2c66	A	G	19: 39,141,925	Y68C	probably damaging	Het
Dicer1	G	A	12: 104,702,451	T1324M	probably benign	Het
Dlgap2	A	G	8: 14,727,562	D268G	probably benign	Het
Dnm1	T	A	2: 32,316,989	M535L	possibly damaging	Het
Dock7	A	T	4: 98,962,280	F1575Y	probably benign	Het
Dpp10	T	A	1: 123,398,546	H403L	possibly damaging	Het
Dync1h1	A	G	12: 110,649,851	D3112G	possibly damaging	Het
Eno3	A	G	11: 70,657,935	E21G	probably null	Het
Fam120b	T	A	17: 15,422,924	V655D	probably damaging	Het
Fam129a	A	G	1: 151,718,216	D884G	probably benign	Het
Fkbp5	A	T	17: 28,428,452	D136E	probably benign	Het
Gdap1l1	T	A	2: 163,447,653	Y179*	probably null	Het
Gfer	A	G	17: 24,694,303	W192R	probably damaging	Het
Gm4782	A	G	6: 50,609,858	T408A	probably benign	Het
Golgb1	C	T	16: 36,875,630	Q164*	probably null	Het
Gpnmb	A	G	6: 49,047,342	N197S	probably damaging	Het
Gtf2f1	G	A	17: 57,003,802	T414M	probably benign	Het
Hc	A	G	2: 35,036,154		probably benign	Het
Hcfc1	A	T	X: 73,948,429		probably benign	Het
Helz2	C	T	2: 181,230,430	R2539Q	probably damaging	Het
Hsd17b12	T	A	2: 94,157,815	I19F	probably benign	Het
Incenp	T	C	19: 9,893,750	T172A	unknown	Het
Jmy	A	G	13: 93,441,618	Y681H	probably benign	Het
Kbtbd11	A	G	8: 15,027,508	T36A	probably benign	Het
Kcnh4	T	C	11: 100,755,699	D267G	probably damaging	Het
Krt34	C	T	11: 100,041,331	E56K	probably damaging	Het
Krt40	T	A	11: 99,538,742	E335D	probably damaging	Het
Krt86	T	A	15: 101,476,573	Y282*	probably null	Het
Lgi3	C	T	14: 70,534,815	R267*	probably null	Het
Lnpk	A	G	2: 74,537,289		probably benign	Het
Lrrc8e	G	A	8: 4,235,401	R542H	probably benign	Het
Mia2	T	C	12: 59,108,856	Y452H	probably damaging	Het
Mmachc	C	T	4: 116,704,541	R132Q	probably damaging	Het
Mtbp	T	A	15: 55,577,486	N356K	possibly damaging	Het
Mum1	T	C	10: 80,234,258	S354P	probably benign	Het
Myo5b	A	G	18: 74,661,716	H552R	possibly damaging	Het
Noxred1	A	G	12: 87,226,979	V96A	probably benign	Het
Nr1d2	T	A	14: 18,211,933	D390V	possibly damaging	Het
Oas1e	A	T	5: 120,791,774		probably benign	Het
Olfr398	T	C	11: 73,983,712	S299G	probably benign	Het
Olfr786	T	A	10: 129,437,348	Y179N	probably damaging	Het
Otog	G	T	7: 46,267,381	C914F	probably damaging	Het
Pank2	G	T	2: 131,280,197	C214F	probably damaging	Het
Pcdhb1	T	A	18: 37,266,735	S580T	probably benign	Het
Pdia3	T	C	2: 121,414,111	S2P	probably damaging	Het
Peli1	G	T	11: 21,142,602	R83L	probably damaging	Het
Pla2g3	T	A	11: 3,491,935	C366*	probably null	Het
Pon3	T	A	6: 5,240,860	D107V	probably benign	Het
Ppip5k2	A	G	1: 97,741,091	C532R	probably damaging	Het
Prph	A	T	15: 99,055,727	D174V	probably damaging	Het
Psd3	A	G	8: 67,758,086	M270T	probably damaging	Het
Pum3	A	G	19: 27,422,755		probably benign	Het
Pus1	A	T	5: 110,779,798	H30Q	probably benign	Het
Rab7	A	T	6: 88,005,132	V87E	probably damaging	Het
Rbm5	A	T	9: 107,751,708		probably benign	Het
Reln	A	G	5: 21,942,597		probably null	Het
S1pr3	A	G	13: 51,418,902	T40A	probably benign	Het
Sdk1	T	A	5: 142,143,922		probably benign	Het
Senp7	T	A	16: 56,179,521	I853N	probably damaging	Het
Serpinb6c	T	A	13: 33,899,247		probably benign	Het
Shroom1	T	G	11: 53,465,485		probably null	Het
Slc24a3	T	C	2: 145,606,664	I376T	probably benign	Het
Slc46a1	T	C	11: 78,468,667	I375T	possibly damaging	Het
Slc4a9	T	C	18: 36,533,680	F527S	probably damaging	Het
Slc4a9	T	A	18: 36,541,233	I924N	probably damaging	Het
Slx4	T	A	16: 3,986,952	E666V	probably damaging	Het
Snrnp27	G	A	6: 86,675,593		probably benign	Het
Sorcs1	C	T	19: 50,228,221	G640E	probably damaging	Het
Sptan1	A	T	2: 30,018,401	M1725L	probably benign	Het
Sync	G	A	4: 129,293,721	R182K	probably damaging	Het
Syne2	G	A	12: 76,098,034	G1586S	probably damaging	Het
Sytl1	G	T	4: 133,253,457	T522K	probably damaging	Het
Tex2	T	A	11: 106,519,955	K414*	probably null	Het
Thegl	G	T	5: 77,016,305	E52*	probably null	Het
Thsd7a	G	A	6: 12,503,916	T413I	probably benign	Het
Tm9sf1	C	T	14: 55,637,935	A451T	possibly damaging	Het
Ttn	A	T	2: 76,826,152		probably benign	Het
Uba2	T	C	7: 34,154,629	I140V	possibly damaging	Het
Ushbp1	C	A	8: 71,390,118	G361*	probably null	Het
Wbp2nl	C	T	15: 82,313,787	A175V	probably benign	Het
Zc3h12d	A	G	10: 7,862,566	E212G	probably damaging	Het
Zc3h7b	T	C	15: 81,768,830		probably benign	Het

Other mutations in Lrp1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Lrp1b	APN	2	41110861	missense	probably damaging	1.00
IGL00543:Lrp1b	APN	2	41468948	missense	possibly damaging	0.69
IGL00578:Lrp1b	APN	2	40679173	missense	unknown
IGL01020:Lrp1b	APN	2	40998247	missense	probably damaging	1.00
IGL01092:Lrp1b	APN	2	40750947	missense	probably damaging	0.97
IGL01155:Lrp1b	APN	2	41770935	missense	probably benign	0.17
IGL01361:Lrp1b	APN	2	41110751	splice site	probably benign
IGL01377:Lrp1b	APN	2	40601538	missense	probably damaging	1.00
IGL01459:Lrp1b	APN	2	40860714	missense	probably damaging	0.97
IGL01473:Lrp1b	APN	2	40611486	missense	probably damaging	0.97
IGL01528:Lrp1b	APN	2	40919182	missense	probably damaging	0.99
IGL01536:Lrp1b	APN	2	41110883	missense	probably benign	0.01
IGL01564:Lrp1b	APN	2	40677486	splice site	probably benign
IGL01747:Lrp1b	APN	2	40860685	missense	probably damaging	1.00
IGL01764:Lrp1b	APN	2	40697442	missense	unknown
IGL01783:Lrp1b	APN	2	41312572	missense	probably damaging	1.00
IGL01802:Lrp1b	APN	2	41511482	missense	probably benign	0.07
IGL01826:Lrp1b	APN	2	41449234	missense	probably damaging	1.00
IGL01884:Lrp1b	APN	2	41284213	nonsense	probably null
IGL01908:Lrp1b	APN	2	40702804	missense	probably benign
IGL01935:Lrp1b	APN	2	41268355	missense	probably damaging	1.00
IGL01959:Lrp1b	APN	2	41312527	missense	probably damaging	0.99
IGL02010:Lrp1b	APN	2	41468942	missense	probably damaging	1.00
IGL02022:Lrp1b	APN	2	41282160	missense	probably damaging	1.00
IGL02028:Lrp1b	APN	2	41511452	missense	probably damaging	1.00
IGL02034:Lrp1b	APN	2	41268370	nonsense	probably null
IGL02043:Lrp1b	APN	2	40697525	missense	probably null	0.44
IGL02066:Lrp1b	APN	2	41111079	nonsense	probably null
IGL02085:Lrp1b	APN	2	40889309	missense	probably benign
IGL02137:Lrp1b	APN	2	40730688	splice site	probably benign
IGL02218:Lrp1b	APN	2	41295672	missense	probably benign	0.11
IGL02409:Lrp1b	APN	2	41445196	missense	possibly damaging	0.93
IGL02513:Lrp1b	APN	2	41110753	critical splice donor site	probably null
IGL02543:Lrp1b	APN	2	40870401	missense	possibly damaging	0.89
IGL02701:Lrp1b	APN	2	41246017	missense	possibly damaging	0.50
IGL02728:Lrp1b	APN	2	40801398	missense	probably benign	0.03
IGL02739:Lrp1b	APN	2	41498215	missense	probably damaging	1.00
IGL02748:Lrp1b	APN	2	40702749	missense	probably damaging	0.99
IGL02754:Lrp1b	APN	2	40702794	missense	probably benign	0.02
IGL02797:Lrp1b	APN	2	41671057	missense
IGL02813:Lrp1b	APN	2	40679217	critical splice acceptor site	probably null
IGL02831:Lrp1b	APN	2	41193591	missense	probably damaging	1.00
IGL02869:Lrp1b	APN	2	40701830	missense	unknown
IGL02946:Lrp1b	APN	2	41312559	missense	probably damaging	1.00
IGL02952:Lrp1b	APN	2	41506703	missense	probably benign	0.33
IGL02958:Lrp1b	APN	2	41302916	missense	probably damaging	1.00
IGL02977:Lrp1b	APN	2	40730735	missense	probably damaging	1.00
IGL03001:Lrp1b	APN	2	40927889	missense	probably damaging	1.00
IGL03010:Lrp1b	APN	2	42323606	missense	possibly damaging	0.94
IGL03060:Lrp1b	APN	2	40637753	missense	probably benign	0.04
IGL03129:Lrp1b	APN	2	41312466	splice site	probably benign
IGL03166:Lrp1b	APN	2	41111038	missense	probably damaging	1.00
IGL03170:Lrp1b	APN	2	40697444	missense	unknown
IGL03195:Lrp1b	APN	2	41471122	missense	possibly damaging	0.95
IGL03224:Lrp1b	APN	2	41471031	missense	possibly damaging	0.92
IGL03251:Lrp1b	APN	2	40600267	missense	probably benign	0.20
IGL03281:Lrp1b	APN	2	40725514	missense	probably benign	0.01
IGL03295:Lrp1b	APN	2	40678987	splice site	probably null
IGL03340:Lrp1b	APN	2	41468969	missense	probably damaging	0.97
IGL03391:Lrp1b	APN	2	41295641	missense	possibly damaging	0.95
IGL03401:Lrp1b	APN	2	41110778	missense	probably benign	0.18
IGL03403:Lrp1b	APN	2	40702824	missense	probably benign	0.16
IGL03408:Lrp1b	APN	2	40858582	missense	probably damaging	0.97
Fetching	UTSW	2	40879555	missense	probably benign	0.00
Heiden	UTSW	2	40637775	missense	probably benign	0.00
hither	UTSW	2	40702848	missense	probably benign	0.00
Roeslein	UTSW	2	40725907	missense	probably damaging	1.00
I2288:Lrp1b	UTSW	2	41122932	missense	probably damaging	0.99
I2289:Lrp1b	UTSW	2	41122932	missense	probably damaging	0.99
LCD18:Lrp1b	UTSW	2	42237562	intron	probably benign
PIT4431001:Lrp1b	UTSW	2	41004755	missense
PIT4585001:Lrp1b	UTSW	2	41269204	missense
R0022:Lrp1b	UTSW	2	40998038	splice site	probably benign
R0022:Lrp1b	UTSW	2	40998038	splice site	probably benign
R0054:Lrp1b	UTSW	2	40742817	missense	probably benign	0.11
R0054:Lrp1b	UTSW	2	40742817	missense	probably benign	0.11
R0094:Lrp1b	UTSW	2	41282030	unclassified	probably benign
R0102:Lrp1b	UTSW	2	41408985	splice site	probably benign
R0123:Lrp1b	UTSW	2	40596983	missense	probably damaging	1.00
R0128:Lrp1b	UTSW	2	41511508	missense	probably damaging	1.00
R0130:Lrp1b	UTSW	2	41511508	missense	probably damaging	1.00
R0134:Lrp1b	UTSW	2	40596983	missense	probably damaging	1.00
R0135:Lrp1b	UTSW	2	41269239	missense	probably damaging	0.99
R0153:Lrp1b	UTSW	2	41123019	missense	possibly damaging	0.92
R0178:Lrp1b	UTSW	2	40725907	missense	probably damaging	1.00
R0225:Lrp1b	UTSW	2	40596983	missense	probably damaging	1.00
R0242:Lrp1b	UTSW	2	40998183	missense	probably benign	0.01
R0312:Lrp1b	UTSW	2	41282171	missense	probably damaging	1.00
R0325:Lrp1b	UTSW	2	40851711	missense	probably damaging	1.00
R0330:Lrp1b	UTSW	2	40701761	nonsense	probably null
R0372:Lrp1b	UTSW	2	40730798	missense	probably benign	0.30
R0400:Lrp1b	UTSW	2	40750914	missense	probably benign	0.40
R0408:Lrp1b	UTSW	2	40677591	missense	probably damaging	1.00
R0498:Lrp1b	UTSW	2	41458405	missense	probably benign	0.19
R0563:Lrp1b	UTSW	2	40750914	missense	probably benign	0.40
R0569:Lrp1b	UTSW	2	40889239	missense	probably benign	0.11
R0622:Lrp1b	UTSW	2	41728551	critical splice donor site	probably null
R0682:Lrp1b	UTSW	2	41295641	missense	probably benign	0.01
R0727:Lrp1b	UTSW	2	40750944	missense	probably benign	0.40
R0747:Lrp1b	UTSW	2	40870341	missense	probably damaging	1.00
R0761:Lrp1b	UTSW	2	41185935	missense	probably damaging	0.99
R0905:Lrp1b	UTSW	2	41284185	missense	probably damaging	1.00
R0959:Lrp1b	UTSW	2	41268354	missense	possibly damaging	0.83
R1124:Lrp1b	UTSW	2	40875051	missense	probably damaging	1.00
R1158:Lrp1b	UTSW	2	40677494	missense	unknown
R1265:Lrp1b	UTSW	2	41476654	missense	probably damaging	1.00
R1276:Lrp1b	UTSW	2	41728576	missense	probably benign	0.35
R1277:Lrp1b	UTSW	2	40725945	missense	probably benign
R1282:Lrp1b	UTSW	2	40860761	missense	probably damaging	1.00
R1291:Lrp1b	UTSW	2	41341895	missense	probably benign	0.05
R1316:Lrp1b	UTSW	2	40702804	missense	probably benign
R1340:Lrp1b	UTSW	2	40702794	missense	probably benign	0.02
R1371:Lrp1b	UTSW	2	40647153	missense	probably damaging	1.00
R1415:Lrp1b	UTSW	2	40629664	missense	probably damaging	1.00
R1416:Lrp1b	UTSW	2	40998216	missense	probably damaging	1.00
R1417:Lrp1b	UTSW	2	41004641	missense	probably benign	0.14
R1465:Lrp1b	UTSW	2	41111059	missense	probably benign	0.00
R1465:Lrp1b	UTSW	2	41111059	missense	probably benign	0.00
R1467:Lrp1b	UTSW	2	40657356	splice site	probably benign
R1468:Lrp1b	UTSW	2	40927829	critical splice donor site	probably null
R1468:Lrp1b	UTSW	2	40927829	critical splice donor site	probably null
R1480:Lrp1b	UTSW	2	40903389	missense	probably damaging	1.00
R1488:Lrp1b	UTSW	2	41502024	missense	probably benign	0.01
R1496:Lrp1b	UTSW	2	42323662	missense	probably damaging	0.98
R1542:Lrp1b	UTSW	2	41123712	missense	probably damaging	1.00
R1571:Lrp1b	UTSW	2	41476646	missense	probably damaging	1.00
R1598:Lrp1b	UTSW	2	41511478	missense	probably damaging	1.00
R1619:Lrp1b	UTSW	2	40697589	missense	unknown
R1697:Lrp1b	UTSW	2	40822683	missense	probably damaging	0.99
R1698:Lrp1b	UTSW	2	40851806	nonsense	probably null
R1699:Lrp1b	UTSW	2	41185962	missense	possibly damaging	0.91
R1715:Lrp1b	UTSW	2	41185981	missense	probably damaging	1.00
R1748:Lrp1b	UTSW	2	41728706	missense	possibly damaging	0.56
R1756:Lrp1b	UTSW	2	41110825	missense	probably damaging	1.00
R1889:Lrp1b	UTSW	2	40919167	nonsense	probably null
R1895:Lrp1b	UTSW	2	40665147	missense	unknown
R1902:Lrp1b	UTSW	2	40860661	missense	probably damaging	1.00
R1919:Lrp1b	UTSW	2	41728729	missense	probably benign	0.00
R1939:Lrp1b	UTSW	2	40697589	missense	unknown
R1946:Lrp1b	UTSW	2	40665147	missense	unknown
R1954:Lrp1b	UTSW	2	40858441	missense	probably damaging	1.00
R1970:Lrp1b	UTSW	2	40875069	missense	probably damaging	1.00
R1983:Lrp1b	UTSW	2	41511404	critical splice donor site	probably null
R2029:Lrp1b	UTSW	2	41341849	missense	probably benign	0.02
R2054:Lrp1b	UTSW	2	40697482	missense	unknown
R2108:Lrp1b	UTSW	2	41110757	missense	probably damaging	1.00
R2158:Lrp1b	UTSW	2	40879555	missense	probably benign	0.00
R2168:Lrp1b	UTSW	2	41375846	missense	probably damaging	1.00
R2184:Lrp1b	UTSW	2	40730702	missense	probably benign
R2188:Lrp1b	UTSW	2	41408959	missense	probably benign	0.25
R2200:Lrp1b	UTSW	2	41284165	missense	probably benign	0.43
R2342:Lrp1b	UTSW	2	40919196	missense	possibly damaging	0.89
R2421:Lrp1b	UTSW	2	40882133	splice site	probably benign
R2656:Lrp1b	UTSW	2	41511581	missense	probably damaging	0.99
R2864:Lrp1b	UTSW	2	40874995	missense	possibly damaging	0.92
R2874:Lrp1b	UTSW	2	40851693	missense	probably damaging	1.00
R2911:Lrp1b	UTSW	2	41506692	missense	probably benign	0.00
R2919:Lrp1b	UTSW	2	41770899	missense	probably damaging	1.00
R3027:Lrp1b	UTSW	2	40870271	missense	probably benign	0.33
R3083:Lrp1b	UTSW	2	40600324	missense	probably damaging	0.99
R3545:Lrp1b	UTSW	2	40600288	missense	probably damaging	1.00
R3546:Lrp1b	UTSW	2	40600288	missense	probably damaging	1.00
R3547:Lrp1b	UTSW	2	40600288	missense	probably damaging	1.00
R3709:Lrp1b	UTSW	2	40697442	missense	unknown
R3817:Lrp1b	UTSW	2	40876658	missense	probably damaging	1.00
R3876:Lrp1b	UTSW	2	41445194	missense	probably damaging	1.00
R3877:Lrp1b	UTSW	2	41445194	missense	probably damaging	1.00
R3896:Lrp1b	UTSW	2	40922428	splice site	probably null
R3901:Lrp1b	UTSW	2	40822695	missense	probably damaging	1.00
R3915:Lrp1b	UTSW	2	41449236	missense	probably damaging	1.00
R3922:Lrp1b	UTSW	2	40677581	missense	unknown
R3964:Lrp1b	UTSW	2	41312470	splice site	probably benign
R4013:Lrp1b	UTSW	2	40802984	missense	possibly damaging	0.66
R4014:Lrp1b	UTSW	2	40802984	missense	possibly damaging	0.66
R4015:Lrp1b	UTSW	2	40802984	missense	possibly damaging	0.66
R4017:Lrp1b	UTSW	2	40802984	missense	possibly damaging	0.66
R4031:Lrp1b	UTSW	2	40702848	missense	probably benign	0.00
R4095:Lrp1b	UTSW	2	41449191	missense	probably benign	0.03
R4108:Lrp1b	UTSW	2	40665087	missense	unknown
R4176:Lrp1b	UTSW	2	41408393	missense	probably damaging	1.00
R4181:Lrp1b	UTSW	2	40611434	missense	probably damaging	1.00
R4359:Lrp1b	UTSW	2	40903065	missense	probably damaging	1.00
R4410:Lrp1b	UTSW	2	40665082	missense	possibly damaging	0.96
R4416:Lrp1b	UTSW	2	40663667	missense	unknown
R4489:Lrp1b	UTSW	2	40661489	unclassified	probably benign
R4577:Lrp1b	UTSW	2	40821719	missense	probably damaging	1.00
R4623:Lrp1b	UTSW	2	41246021	missense	probably damaging	1.00
R4677:Lrp1b	UTSW	2	40801484	missense	probably damaging	1.00
R4684:Lrp1b	UTSW	2	40922304	missense	probably benign	0.44
R4714:Lrp1b	UTSW	2	41110759	missense	possibly damaging	0.90
R4721:Lrp1b	UTSW	2	40715369	splice site	probably null
R4755:Lrp1b	UTSW	2	41269273	missense	probably benign	0.07
R4755:Lrp1b	UTSW	2	41471016	missense	probably benign
R4774:Lrp1b	UTSW	2	40661532	missense	probably null	1.00
R4854:Lrp1b	UTSW	2	41111077	missense	probably damaging	1.00
R4880:Lrp1b	UTSW	2	41770919	missense	probably benign	0.07
R4885:Lrp1b	UTSW	2	41468893	missense	probably benign
R4901:Lrp1b	UTSW	2	40821645	missense	probably damaging	1.00
R4919:Lrp1b	UTSW	2	40647234	missense	probably benign	0.25
R4935:Lrp1b	UTSW	2	41498393	missense	probably benign	0.01
R4937:Lrp1b	UTSW	2	40802885	splice site	probably null
R4967:Lrp1b	UTSW	2	41788974	missense	probably damaging	1.00
R4968:Lrp1b	UTSW	2	40702707	splice site	probably null
R4968:Lrp1b	UTSW	2	41789062	missense	probably damaging	1.00
R5155:Lrp1b	UTSW	2	41728622	splice site	probably null
R5221:Lrp1b	UTSW	2	41112982	missense	possibly damaging	0.79
R5224:Lrp1b	UTSW	2	41110840	missense	possibly damaging	0.61
R5227:Lrp1b	UTSW	2	40851793	missense	possibly damaging	0.95
R5246:Lrp1b	UTSW	2	41470940	critical splice donor site	probably null
R5263:Lrp1b	UTSW	2	41960679	missense	probably damaging	1.00
R5274:Lrp1b	UTSW	2	41344444	missense	probably null	1.00
R5291:Lrp1b	UTSW	2	40903003	missense	probably damaging	1.00
R5362:Lrp1b	UTSW	2	41375902	missense	probably damaging	1.00
R5365:Lrp1b	UTSW	2	40647125	missense	possibly damaging	0.55
R5369:Lrp1b	UTSW	2	41004613	nonsense	probably null
R5419:Lrp1b	UTSW	2	40730704	nonsense	probably null
R5434:Lrp1b	UTSW	2	41770868	missense	probably damaging	0.96
R5452:Lrp1b	UTSW	2	40922316	missense	probably damaging	1.00
R5453:Lrp1b	UTSW	2	41282237	missense	probably damaging	1.00
R5496:Lrp1b	UTSW	2	40927973	missense	probably benign	0.02
R5524:Lrp1b	UTSW	2	41110888	missense	probably damaging	1.00
R5538:Lrp1b	UTSW	2	40697474	missense	unknown
R5571:Lrp1b	UTSW	2	41408342	missense	probably damaging	0.97
R5577:Lrp1b	UTSW	2	40875123	missense	possibly damaging	0.70
R5609:Lrp1b	UTSW	2	41341795	missense	probably damaging	1.00
R5635:Lrp1b	UTSW	2	42652822	utr 5 prime	probably benign
R5669:Lrp1b	UTSW	2	41111038	missense	probably damaging	1.00
R5672:Lrp1b	UTSW	2	41341759	missense	probably benign	0.01
R5690:Lrp1b	UTSW	2	40750894	splice site	probably null
R5752:Lrp1b	UTSW	2	41295612	missense	probably damaging	1.00
R5853:Lrp1b	UTSW	2	40663726	missense	unknown
R5869:Lrp1b	UTSW	2	41004603	missense	probably damaging	0.98
R5880:Lrp1b	UTSW	2	41341814	missense	probably benign	0.23
R5887:Lrp1b	UTSW	2	40821707	missense	possibly damaging	0.91
R5893:Lrp1b	UTSW	2	40601587	missense	probably damaging	1.00
R5894:Lrp1b	UTSW	2	41498221	missense	probably benign	0.11
R6019:Lrp1b	UTSW	2	41302970	missense	probably damaging	1.00
R6019:Lrp1b	UTSW	2	41476809	missense	probably damaging	1.00
R6021:Lrp1b	UTSW	2	41344427	missense	probably benign	0.02
R6045:Lrp1b	UTSW	2	40701813	missense	unknown
R6047:Lrp1b	UTSW	2	40637775	missense	probably benign	0.00
R6060:Lrp1b	UTSW	2	40750934	missense
R6063:Lrp1b	UTSW	2	41284144	nonsense	probably null
R6090:Lrp1b	UTSW	2	41185868	critical splice donor site	probably null
R6112:Lrp1b	UTSW	2	41341882	missense	probably benign	0.14
R6128:Lrp1b	UTSW	2	40860655	missense	probably benign
R6149:Lrp1b	UTSW	2	40875153	splice site	probably null
R6174:Lrp1b	UTSW	2	41449263	missense	probably benign
R6177:Lrp1b	UTSW	2	41123736	splice site	probably null
R6257:Lrp1b	UTSW	2	40596969	splice site	probably null
R6267:Lrp1b	UTSW	2	40657525	missense	probably benign	0.00
R6268:Lrp1b	UTSW	2	40821717	missense	probably benign	0.01
R6331:Lrp1b	UTSW	2	40803209	missense	probably damaging	1.00
R6334:Lrp1b	UTSW	2	41789033	missense	probably benign
R6359:Lrp1b	UTSW	2	41295596	missense	probably damaging	1.00
R6371:Lrp1b	UTSW	2	40851654	missense	possibly damaging	0.61
R6421:Lrp1b	UTSW	2	40889270	missense	probably damaging	1.00
R6524:Lrp1b	UTSW	2	40851804	missense	possibly damaging	0.95
R6616:Lrp1b	UTSW	2	40699631	missense	unknown
R6632:Lrp1b	UTSW	2	40725442	missense	probably benign	0.23
R6656:Lrp1b	UTSW	2	40637864	nonsense	probably null
R6698:Lrp1b	UTSW	2	41302946	missense	probably damaging	1.00
R6741:Lrp1b	UTSW	2	41245989	missense	possibly damaging	0.82
R6742:Lrp1b	UTSW	2	41471120	missense	probably benign	0.31
R6811:Lrp1b	UTSW	2	40715500	splice site	probably null
R6811:Lrp1b	UTSW	2	41449194	missense	probably benign	0.01
R6855:Lrp1b	UTSW	2	40628696	missense	possibly damaging	0.66
R6888:Lrp1b	UTSW	2	41471126	missense	probably benign	0.18
R6946:Lrp1b	UTSW	2	40697439	missense	probably benign
R6984:Lrp1b	UTSW	2	40822628	missense	probably damaging	0.97
R7026:Lrp1b	UTSW	2	41269222	missense	probably damaging	1.00
R7028:Lrp1b	UTSW	2	41246011	missense	probably benign	0.45
R7036:Lrp1b	UTSW	2	41112342	missense	possibly damaging	0.89
R7043:Lrp1b	UTSW	2	40922414	missense	possibly damaging	0.84
R7071:Lrp1b	UTSW	2	41408264	missense
R7077:Lrp1b	UTSW	2	41770846	missense
R7115:Lrp1b	UTSW	2	40998235	missense
R7143:Lrp1b	UTSW	2	41312643	missense
R7146:Lrp1b	UTSW	2	41375994	nonsense	probably null
R7149:Lrp1b	UTSW	2	40637860	missense
R7185:Lrp1b	UTSW	2	40801512	critical splice acceptor site	probably null
R7239:Lrp1b	UTSW	2	41004713	missense
R7247:Lrp1b	UTSW	2	41269212	missense
R7331:Lrp1b	UTSW	2	40663610	splice site	probably null
R7369:Lrp1b	UTSW	2	41282039	missense
R7378:Lrp1b	UTSW	2	41295669	missense
R7381:Lrp1b	UTSW	2	40802917	missense
R7406:Lrp1b	UTSW	2	41376018	critical splice acceptor site	probably null
R7437:Lrp1b	UTSW	2	40822645	missense
R7437:Lrp1b	UTSW	2	40822646	missense
R7446:Lrp1b	UTSW	2	41671057	missense
R7460:Lrp1b	UTSW	2	40598466	missense
R7462:Lrp1b	UTSW	2	41113029	missense
R7475:Lrp1b	UTSW	2	41344576	missense
R7479:Lrp1b	UTSW	2	40801505	missense
R7523:Lrp1b	UTSW	2	41511461	missense
R7525:Lrp1b	UTSW	2	40657416	missense
R7549:Lrp1b	UTSW	2	40875122	missense
R7552:Lrp1b	UTSW	2	40677570	missense
R7558:Lrp1b	UTSW	2	41341936	missense
R7587:Lrp1b	UTSW	2	40730717	missense
R7599:Lrp1b	UTSW	2	40661549	missense
R7635:Lrp1b	UTSW	2	41123597	critical splice donor site	probably null
R7663:Lrp1b	UTSW	2	42653035	unclassified	probably benign
R7674:Lrp1b	UTSW	2	42652909	start gained	probably benign
R7681:Lrp1b	UTSW	2	40874999	nonsense	probably null
R7703:Lrp1b	UTSW	2	41110786	missense
R7742:Lrp1b	UTSW	2	40822629	missense
R7767:Lrp1b	UTSW	2	40801505	missense
R7829:Lrp1b	UTSW	2	40903448	nonsense	probably null
R7861:Lrp1b	UTSW	2	40697558	missense
R7868:Lrp1b	UTSW	2	41449234	missense
R7883:Lrp1b	UTSW	2	40665129	missense
R7956:Lrp1b	UTSW	2	41282149	splice site	probably null
R7963:Lrp1b	UTSW	2	40927935	missense
R7964:Lrp1b	UTSW	2	40598511	missense
R8035:Lrp1b	UTSW	2	40860655	missense
R8046:Lrp1b	UTSW	2	41269187	missense
R8128:Lrp1b	UTSW	2	41269236	missense	probably null
R8234:Lrp1b	UTSW	2	41312656	missense
R8237:Lrp1b	UTSW	2	40851774	missense
R8244:Lrp1b	UTSW	2	41506782	missense
R8370:Lrp1b	UTSW	2	40998105	missense
R8395:Lrp1b	UTSW	2	40657399	missense
R8398:Lrp1b	UTSW	2	40701807	missense
R8421:Lrp1b	UTSW	2	40725423	missense
R8426:Lrp1b	UTSW	2	41498306	missense
R8443:Lrp1b	UTSW	2	41375855	nonsense	probably null
R8444:Lrp1b	UTSW	2	40870260	missense
R8486:Lrp1b	UTSW	2	41728690	missense	probably damaging	1.00
R8500:Lrp1b	UTSW	2	41506779	missense	probably benign	0.12
R8507:Lrp1b	UTSW	2	41408375	missense
R8552:Lrp1b	UTSW	2	41408981	missense	probably benign	0.00
R8554:Lrp1b	UTSW	2	41344483	missense	probably benign	0.28
R8669:Lrp1b	UTSW	2	41282035	critical splice donor site	probably null
R8699:Lrp1b	UTSW	2	41282195	missense
R8796:Lrp1b	UTSW	2	40903414	missense
R8815:Lrp1b	UTSW	2	40665159	missense
R8842:Lrp1b	UTSW	2	41268405	missense
R8858:Lrp1b	UTSW	2	41670815	intron	probably benign
R8864:Lrp1b	UTSW	2	41112706	missense
R8918:Lrp1b	UTSW	2	40725881	missense
R8920:Lrp1b	UTSW	2	42323598	missense
R8963:Lrp1b	UTSW	2	40998184	missense	probably benign	0.28
R8971:Lrp1b	UTSW	2	41435628	missense
R9007:Lrp1b	UTSW	2	40697552	missense
R9042:Lrp1b	UTSW	2	41502017	missense
R9053:Lrp1b	UTSW	2	40858489	missense
R9063:Lrp1b	UTSW	2	41341826	missense
R9072:Lrp1b	UTSW	2	40725445	nonsense	probably null
R9105:Lrp1b	UTSW	2	41506791	missense
R9131:Lrp1b	UTSW	2	40699578	nonsense	probably null
R9226:Lrp1b	UTSW	2	41511448	missense
R9245:Lrp1b	UTSW	2	40598444	missense
R9275:Lrp1b	UTSW	2	40597064	missense
R9278:Lrp1b	UTSW	2	40597064	missense
R9303:Lrp1b	UTSW	2	41728562	missense
R9305:Lrp1b	UTSW	2	41728562	missense
R9306:Lrp1b	UTSW	2	40628750	missense	possibly damaging	0.66
R9320:Lrp1b	UTSW	2	41445099	critical splice donor site	probably null
R9330:Lrp1b	UTSW	2	41122981	missense
R9352:Lrp1b	UTSW	2	40858426	missense
R9386:Lrp1b	UTSW	2	41123628	missense
R9397:Lrp1b	UTSW	2	40750910	missense
R9444:Lrp1b	UTSW	2	41123718	missense
R9452:Lrp1b	UTSW	2	41960714	nonsense	probably null
R9474:Lrp1b	UTSW	2	40601587	missense	probably damaging	1.00
R9501:Lrp1b	UTSW	2	41282235	missense
R9523:Lrp1b	UTSW	2	41770966	missense
R9541:Lrp1b	UTSW	2	41344588	missense
R9555:Lrp1b	UTSW	2	40851681	missense
R9555:Lrp1b	UTSW	2	40858426	missense
R9563:Lrp1b	UTSW	2	41295699	missense
R9568:Lrp1b	UTSW	2	40679215	missense
R9622:Lrp1b	UTSW	2	40889342	nonsense	probably null
R9623:Lrp1b	UTSW	2	41476636	missense
R9634:Lrp1b	UTSW	2	41245939	critical splice donor site	probably null
R9640:Lrp1b	UTSW	2	41188917	missense
R9664:Lrp1b	UTSW	2	40874992	missense
R9668:Lrp1b	UTSW	2	41185970	missense
R9672:Lrp1b	UTSW	2	40889279	missense
R9717:Lrp1b	UTSW	2	41268383	missense
R9741:Lrp1b	UTSW	2	41112288	missense
RF018:Lrp1b	UTSW	2	41110907	missense
RF020:Lrp1b	UTSW	2	41770846	missense
V1662:Lrp1b	UTSW	2	41122932	missense	probably damaging	0.99
X0028:Lrp1b	UTSW	2	41471145	missense	probably damaging	1.00
X0064:Lrp1b	UTSW	2	41502043	missense	probably damaging	1.00
Z1176:Lrp1b	UTSW	2	40677506	missense
Z1176:Lrp1b	UTSW	2	40697582	missense
Z1176:Lrp1b	UTSW	2	40922383	missense
Z1176:Lrp1b	UTSW	2	41728710	missense
Z1177:Lrp1b	UTSW	2	40637749	missense
Z1177:Lrp1b	UTSW	2	41188848	missense
Z1187:Lrp1b	UTSW	2	40750934	missense
Z1188:Lrp1b	UTSW	2	40750934	missense

Predicted Primers

PCR Primer
(F):5'- TCCTTTATGCCACTCACATTCAGTTCAA -3'
(R):5'- AGAGGCTCTGAACCCTTCTGCT -3'

Sequencing Primer
(F):5'- CCCAGAGTGTAAGTTATTAAAGGTCG -3'
(R):5'- GTTTGAAAGTCCCCAGAAATACTC -3'

Posted On

2013-07-11