Incidental Mutation 'R7721:Zfp654'
ID595246
Institutional Source Beutler Lab
Gene Symbol Zfp654
Ensembl Gene ENSMUSG00000047141
Gene Namezinc finger protein 654
Synonyms1810008K20Rik, 1600021C16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R7721 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location64780347-64851652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 64786207 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 3 (C3F)
Ref Sequence ENSEMBL: ENSMUSP00000052946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052588] [ENSMUST00000207826]
Predicted Effect probably damaging
Transcript: ENSMUST00000052588
AA Change: C3F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052946
Gene: ENSMUSG00000047141
AA Change: C3F

DomainStartEndE-ValueType
ZnF_C2H2 25 47 1.69e-3 SMART
low complexity region 117 132 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
ZnF_C2H2 197 222 1.25e-1 SMART
ZnF_C2H2 238 260 4.65e-1 SMART
ZnF_C2H2 266 290 4.98e-1 SMART
ZnF_C2H2 295 319 7.49e0 SMART
ZnF_C2H2 534 554 1.49e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207826
AA Change: C544F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik C T 9: 36,637,863 G34R possibly damaging Het
Acad10 T C 5: 121,646,866 probably null Het
Adamtsl3 T G 7: 82,606,520 M1580R possibly damaging Het
Alg9 T C 9: 50,776,642 I78T probably damaging Het
Ankmy2 G T 12: 36,157,144 probably benign Het
Ankrd11 G T 8: 122,894,759 L785M probably damaging Het
Atrnl1 T A 19: 57,696,331 D796E probably benign Het
C1s2 A G 6: 124,630,058 V277A possibly damaging Het
Cldn15 A G 5: 136,968,161 M19V probably benign Het
Cldn23 T G 8: 35,826,263 S24R possibly damaging Het
Cnr1 T A 4: 33,944,416 I268N probably damaging Het
Csf2ra A T 19: 61,226,586 W147R probably damaging Het
Ctsb G T 14: 63,133,316 probably benign Het
D430041D05Rik A G 2: 104,258,529 M34T probably benign Het
Dmtf1 T C 5: 9,126,564 I463V probably damaging Het
Dnah7a T A 1: 53,631,683 D470V probably benign Het
Dtx4 A G 19: 12,482,136 S435P probably benign Het
Ear2 T A 14: 44,103,038 M51K probably damaging Het
Elmo1 T A 13: 20,280,803 probably null Het
Faf1 T A 4: 109,736,597 I124N probably damaging Het
Gkap1 A C 13: 58,236,985 probably null Het
Glipr2 T C 4: 43,957,770 S4P probably benign Het
Gm11639 T A 11: 104,724,540 L711* probably null Het
Gm38119 A T 3: 92,738,030 C86S unknown Het
Gm6583 A G 5: 112,355,517 I107T probably benign Het
Gpr171 T G 3: 59,097,899 I152L probably benign Het
Hes7 T A 11: 69,121,526 T9S unknown Het
Homer3 T C 8: 70,291,012 V180A probably benign Het
Irx1 T A 13: 71,960,057 M169L probably benign Het
Kap A G 6: 133,851,727 probably null Het
Mgat5b A G 11: 116,966,801 M2V Het
Mob4 C T 1: 55,148,320 Q76* probably null Het
Olfr1493-ps1 T A 19: 13,726,843 I194N possibly damaging Het
Olfr911-ps1 A T 9: 38,523,717 probably null Het
Olfr943 A G 9: 39,184,760 D191G probably benign Het
Pcdha9 A T 18: 36,999,636 Q586L probably benign Het
Pgk2 T A 17: 40,207,518 I340F probably benign Het
Prex1 G A 2: 166,577,890 Q1289* probably null Het
Prr22 A G 17: 56,771,819 D324G possibly damaging Het
Rab2b A T 14: 52,263,760 S201T probably benign Het
Rdh1 T A 10: 127,760,252 probably null Het
Rhbdl1 G T 17: 25,836,149 N82K probably benign Het
Rspo1 C A 4: 124,991,417 Q29K possibly damaging Het
Rtp3 A T 9: 110,985,880 Y472* probably null Het
Senp5 T A 16: 31,990,434 M1L unknown Het
Slfn4 A T 11: 83,187,563 probably null Het
Stab1 A G 14: 31,141,456 V2091A possibly damaging Het
Stk32c A G 7: 139,188,153 S71P possibly damaging Het
Tpr A G 1: 150,444,429 T2243A probably benign Het
Tubgcp6 A T 15: 89,101,401 N1544K probably damaging Het
Uqcc1 T C 2: 155,858,146 N202S probably benign Het
Vmn2r18 C T 5: 151,586,693 E72K possibly damaging Het
Zfp804b T C 5: 6,771,263 E600G possibly damaging Het
Other mutations in Zfp654
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Zfp654 APN 16 64784641 missense probably benign 0.02
IGL02043:Zfp654 APN 16 64785028 missense probably benign 0.00
IGL02205:Zfp654 APN 16 64785966 missense probably damaging 1.00
IGL02337:Zfp654 APN 16 64785149 missense probably benign 0.00
IGL02398:Zfp654 APN 16 64786018 missense probably benign 0.00
R0025:Zfp654 UTSW 16 64784818 missense probably benign 0.31
R0025:Zfp654 UTSW 16 64784818 missense probably benign 0.31
R0193:Zfp654 UTSW 16 64785688 missense possibly damaging 0.76
R1276:Zfp654 UTSW 16 64785336 missense probably damaging 1.00
R1851:Zfp654 UTSW 16 64785128 missense probably benign 0.34
R4065:Zfp654 UTSW 16 64785925 missense possibly damaging 0.87
R4872:Zfp654 UTSW 16 64785782 missense probably benign 0.28
R5693:Zfp654 UTSW 16 64785926 missense probably benign 0.00
R6362:Zfp654 UTSW 16 64786094 nonsense probably null
R6483:Zfp654 UTSW 16 64791947 missense possibly damaging 0.93
R6666:Zfp654 UTSW 16 64786233 missense probably benign 0.25
R6852:Zfp654 UTSW 16 64786598 missense probably damaging 1.00
R6917:Zfp654 UTSW 16 64786471 missense probably damaging 0.98
R7289:Zfp654 UTSW 16 64785160 missense probably benign
R7506:Zfp654 UTSW 16 64791848 missense probably damaging 0.98
R7598:Zfp654 UTSW 16 64785934 missense possibly damaging 0.49
R7791:Zfp654 UTSW 16 64783271 makesense probably null
R7884:Zfp654 UTSW 16 64851648 missense probably damaging 0.99
R7966:Zfp654 UTSW 16 64784876 missense probably damaging 1.00
R8361:Zfp654 UTSW 16 64791857 missense probably damaging 1.00
Z1176:Zfp654 UTSW 16 64786208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCCTGTTGTGCAGTAGC -3'
(R):5'- GCGTGATAAATCAGCAGTGAAACTTC -3'

Sequencing Primer
(F):5'- GCAATCTGCTGTCTCTGAATC -3'
(R):5'- GATGCGTCTGTAGTGCAA -3'
Posted On2019-11-12