Incidental Mutation 'R7721:Prr22'
ID595249
Institutional Source Beutler Lab
Gene Symbol Prr22
Ensembl Gene ENSMUSG00000090273
Gene Nameproline rich 22
SynonymsLOC224908, Gm546
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7721 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location56770250-56772208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56771819 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 324 (D324G)
Ref Sequence ENSEMBL: ENSMUSP00000127457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002444] [ENSMUST00000007747] [ENSMUST00000086801] [ENSMUST00000168666]
Predicted Effect probably benign
Transcript: ENSMUST00000002444
SMART Domains Protein: ENSMUSP00000002444
Gene: ENSMUSG00000024206

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 4 149 1.9e-50 PFAM
Pfam:RFX_DNA_binding 192 269 4.3e-36 PFAM
Blast:HisKA 479 542 1e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000007747
SMART Domains Protein: ENSMUSP00000007747
Gene: ENSMUSG00000007603

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:ZnF_C3H1 109 136 2e-6 BLAST
Blast:ZnF_C3H1 146 172 6e-9 BLAST
Pfam:Dus 295 566 2e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086801
SMART Domains Protein: ENSMUSP00000084010
Gene: ENSMUSG00000024206

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 151 6.8e-56 PFAM
Pfam:RFX_DNA_binding 161 246 6e-41 PFAM
Blast:HisKA 454 517 1e-31 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000168666
AA Change: D324G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127457
Gene: ENSMUSG00000090273
AA Change: D324G

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
Pfam:PRR22 58 422 2.3e-169 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik T A 11: 69,121,526 T9S unknown Het
A630095E13Rik C T 9: 36,637,863 G34R possibly damaging Het
Adamtsl3 T G 7: 82,606,520 M1580R possibly damaging Het
Alg9 T C 9: 50,776,642 I78T probably damaging Het
Ankrd11 G T 8: 122,894,759 L785M probably damaging Het
Atrnl1 T A 19: 57,696,331 D796E probably benign Het
C1s2 A G 6: 124,630,058 V277A possibly damaging Het
Cldn15 A G 5: 136,968,161 M19V probably benign Het
Cldn23 T G 8: 35,826,263 S24R possibly damaging Het
Cnr1 T A 4: 33,944,416 I268N probably damaging Het
Csf2ra A T 19: 61,226,586 W147R probably damaging Het
Ctsb G T 14: 63,133,316 probably benign Het
D430041D05Rik A G 2: 104,258,529 M34T probably benign Het
Dmtf1 T C 5: 9,126,564 I463V probably damaging Het
Dnah7a T A 1: 53,631,683 D470V probably benign Het
Dtx4 A G 19: 12,482,136 S435P probably benign Het
Ear2 T A 14: 44,103,038 M51K probably damaging Het
Faf1 T A 4: 109,736,597 I124N probably damaging Het
Gkap1 A C 13: 58,236,985 probably null Het
Glipr2 T C 4: 43,957,770 S4P probably benign Het
Gm11639 T A 11: 104,724,540 L711* probably null Het
Gm38119 A T 3: 92,738,030 C86S unknown Het
Gm6583 A G 5: 112,355,517 I107T probably benign Het
Gpr171 T G 3: 59,097,899 I152L probably benign Het
Homer3 T C 8: 70,291,012 V180A probably benign Het
Irx1 T A 13: 71,960,057 M169L probably benign Het
Kap A G 6: 133,851,727 probably null Het
Lyzl4 GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAAGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG 9: 121,583,989 probably null Het
Mgat5b A G 11: 116,966,801 M2V Het
Mob4 C T 1: 55,148,320 Q76* probably null Het
Olfr1493-ps1 T A 19: 13,726,843 I194N possibly damaging Het
Olfr911-ps1 A T 9: 38,523,717 probably null Het
Olfr943 A G 9: 39,184,760 D191G probably benign Het
Pcdha9 A T 18: 36,999,636 Q586L probably benign Het
Pgk2 T A 17: 40,207,518 I340F probably benign Het
Prex1 G A 2: 166,577,890 Q1289* probably null Het
Rab2b A T 14: 52,263,760 S201T probably benign Het
Rdh1 T A 10: 127,760,252 probably null Het
Rhbdl1 G T 17: 25,836,149 N82K probably benign Het
Rspo1 C A 4: 124,991,417 Q29K possibly damaging Het
Rtp3 A T 9: 110,985,880 Y472* probably null Het
Senp5 T A 16: 31,990,434 M1L unknown Het
Stab1 A G 14: 31,141,456 V2091A possibly damaging Het
Stk32c A G 7: 139,188,153 S71P possibly damaging Het
Tpr A G 1: 150,444,429 T2243A probably benign Het
Tubgcp6 A T 15: 89,101,401 N1544K probably damaging Het
Uqcc1 T C 2: 155,858,146 N202S probably benign Het
Vmn2r18 C T 5: 151,586,693 E72K possibly damaging Het
Zfp654 C A 16: 64,786,207 C3F probably damaging Het
Zfp804b T C 5: 6,771,263 E600G possibly damaging Het
Other mutations in Prr22
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0462:Prr22 UTSW 17 56770551 unclassified probably benign
R0787:Prr22 UTSW 17 56771072 missense possibly damaging 0.71
R2290:Prr22 UTSW 17 56771884 missense probably benign
R4749:Prr22 UTSW 17 56771274 missense possibly damaging 0.51
R5099:Prr22 UTSW 17 56771467 missense probably benign 0.32
R6268:Prr22 UTSW 17 56771587 missense probably damaging 0.98
R6339:Prr22 UTSW 17 56771490 missense probably benign 0.02
R6542:Prr22 UTSW 17 56770527 splice site probably null
R6951:Prr22 UTSW 17 56772028 nonsense probably null
R6991:Prr22 UTSW 17 56771345 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTTCTTCCTACCGGACAAGG -3'
(R):5'- GATCAAATGGCTTTAATTGGGGATG -3'

Sequencing Primer
(F):5'- AAGGTCCTTCTCGAAGATGC -3'
(R):5'- CCCTTTCTTGGTGGGCATGC -3'
Posted On2019-11-12