Incidental Mutation 'R7722:Ano7'
ID595258
Institutional Source Beutler Lab
Gene Symbol Ano7
Ensembl Gene ENSMUSG00000034107
Gene Nameanoctamin 7
SynonymsTmem16g, NGEP-L, IPCA-5, NGEP, Pcanap5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7722 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93373930-93404303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93390423 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 286 (A286T)
Ref Sequence ENSEMBL: ENSMUSP00000050495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058682] [ENSMUST00000186641]
Predicted Effect probably damaging
Transcript: ENSMUST00000058682
AA Change: A286T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050495
Gene: ENSMUSG00000034107
AA Change: A286T

DomainStartEndE-ValueType
Pfam:Anoct_dimer 49 274 2.2e-63 PFAM
Pfam:Anoctamin 277 824 3.4e-146 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186641
AA Change: A286T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140438
Gene: ENSMUSG00000034107
AA Change: A286T

DomainStartEndE-ValueType
Pfam:Anoctamin 277 825 6.6e-150 PFAM
Meta Mutation Damage Score 0.1362 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to have little anion conductance activity. In humans, this protein is primarily found in prostate tissues and may serve as a target for prostate cancer immunotherapy. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn A G 17: 13,808,969 E151G probably benign Het
Alpk2 A T 18: 65,350,157 L260H probably damaging Het
Amh T C 10: 80,806,624 V247A probably benign Het
Ank2 T A 3: 127,029,302 I431L probably benign Het
Atp8a1 T A 5: 67,622,698 probably null Het
Brd1 A T 15: 88,729,559 S378T probably damaging Het
Cd163l1 C A 7: 140,222,386 C209* probably null Het
Clrn1 T A 3: 58,846,334 N202I possibly damaging Het
Cspp1 T C 1: 10,074,901 V308A probably benign Het
Cyp2a5 T C 7: 26,837,118 L174P probably benign Het
Ehbp1 G A 11: 22,089,572 H843Y probably null Het
Fancm T A 12: 65,106,461 D1230E probably damaging Het
Fbxl17 A T 17: 63,356,828 N555K probably damaging Het
Fmnl2 A C 2: 53,054,467 S153R Het
Fras1 G A 5: 96,769,554 V3478M probably damaging Het
Gnptab T C 10: 88,379,528 F37S probably damaging Het
Gpr183 T G 14: 121,954,858 I84L probably damaging Het
Hcn1 A G 13: 117,902,778 H410R unknown Het
Hmcn1 A G 1: 150,667,880 V2848A probably damaging Het
Hmcn2 A T 2: 31,382,500 R1331* probably null Het
Hsd17b4 A C 18: 50,146,524 N190T probably damaging Het
Kif14 A G 1: 136,468,295 D113G probably benign Het
Kmt2e T G 5: 23,497,018 D881E probably benign Het
Lamb1 T A 12: 31,323,571 L1481Q probably damaging Het
Limk2 T C 11: 3,356,092 probably null Het
Luc7l2 T A 6: 38,603,308 S281T unknown Het
Map3k5 A G 10: 20,132,145 D1240G probably benign Het
Med13l C A 5: 118,747,407 T1475K probably benign Het
Med17 G T 9: 15,271,691 Q353K probably benign Het
Mlh3 A G 12: 85,267,492 V640A probably benign Het
Mms22l T A 4: 24,517,201 Y361N probably damaging Het
Mtmr2 T A 9: 13,804,808 N532K probably benign Het
Mtss1 G A 15: 59,055,086 T47I probably damaging Het
Mturn T C 6: 54,699,560 probably null Het
Muc20 A C 16: 32,797,386 S3A probably benign Het
Nde1 T C 16: 14,190,264 Y164H unknown Het
Neurl1b A G 17: 26,441,158 T451A probably benign Het
Olfr1537 A T 9: 39,237,589 Y278* probably null Het
Olfr654 C A 7: 104,588,298 Q165K possibly damaging Het
Pgap3 G A 11: 98,390,784 A196V probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sdcbp T A 4: 6,385,063 V94E possibly damaging Het
Sgo2a T G 1: 58,016,537 F627V probably benign Het
Skor2 A C 18: 76,862,644 N889T probably benign Het
Slc35f4 A T 14: 49,306,274 N288K probably benign Het
Slc9b2 T A 3: 135,329,835 V355E probably null Het
Smarcc2 A G 10: 128,481,728 E566G possibly damaging Het
Sorcs2 T C 5: 36,043,527 E559G probably damaging Het
Sphkap T C 1: 83,278,921 D369G probably benign Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Stc1 T A 14: 69,032,280 I103N possibly damaging Het
Stx8 T C 11: 68,203,718 V219A probably damaging Het
Tg C T 15: 66,764,309 R582C possibly damaging Het
Tshz2 T A 2: 169,885,272 L596Q probably benign Het
Tti1 A G 2: 158,007,607 Y571H probably benign Het
Zbtb40 A G 4: 136,991,518 I956T probably damaging Het
Zfp990 A C 4: 145,536,962 N177H possibly damaging Het
Other mutations in Ano7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ano7 APN 1 93402166 missense probably benign 0.04
IGL00838:Ano7 APN 1 93402757 missense possibly damaging 0.91
IGL01295:Ano7 APN 1 93380478 missense probably benign 0.00
IGL01322:Ano7 APN 1 93395508 missense probably benign 0.08
IGL01807:Ano7 APN 1 93402696 missense possibly damaging 0.66
IGL01859:Ano7 APN 1 93394446 missense probably damaging 1.00
IGL02349:Ano7 APN 1 93391490 missense probably benign 0.02
IGL02976:Ano7 APN 1 93402673 missense possibly damaging 0.78
R0360:Ano7 UTSW 1 93388658 missense probably benign 0.01
R0364:Ano7 UTSW 1 93388658 missense probably benign 0.01
R0528:Ano7 UTSW 1 93395502 missense probably null 1.00
R0741:Ano7 UTSW 1 93401587 missense probably damaging 0.97
R1131:Ano7 UTSW 1 93401776 missense probably benign 0.24
R1156:Ano7 UTSW 1 93401852 splice site probably null
R1500:Ano7 UTSW 1 93397328 missense probably damaging 1.00
R1710:Ano7 UTSW 1 93385624 missense probably benign 0.00
R2002:Ano7 UTSW 1 93400581 unclassified probably benign
R2062:Ano7 UTSW 1 93390313 missense probably benign
R2120:Ano7 UTSW 1 93402133 splice site probably benign
R2200:Ano7 UTSW 1 93380436 missense possibly damaging 0.93
R2268:Ano7 UTSW 1 93380439 missense possibly damaging 0.51
R2763:Ano7 UTSW 1 93399186 splice site probably null
R4202:Ano7 UTSW 1 93380478 missense probably benign 0.00
R4204:Ano7 UTSW 1 93380478 missense probably benign 0.00
R4205:Ano7 UTSW 1 93380478 missense probably benign 0.00
R4453:Ano7 UTSW 1 93394353 missense probably damaging 1.00
R4627:Ano7 UTSW 1 93375185 missense probably benign 0.15
R4735:Ano7 UTSW 1 93400494 missense probably benign
R4809:Ano7 UTSW 1 93394566 missense probably benign 0.20
R4935:Ano7 UTSW 1 93395314 missense possibly damaging 0.48
R4970:Ano7 UTSW 1 93397363 missense possibly damaging 0.77
R5112:Ano7 UTSW 1 93397363 missense possibly damaging 0.77
R5249:Ano7 UTSW 1 93375196 missense probably benign
R5813:Ano7 UTSW 1 93384919 critical splice donor site probably null
R6181:Ano7 UTSW 1 93395359 missense probably damaging 1.00
R7106:Ano7 UTSW 1 93374983 splice site probably null
R7113:Ano7 UTSW 1 93385620 missense probably benign 0.10
R7199:Ano7 UTSW 1 93402978 missense
R7218:Ano7 UTSW 1 93380469 missense probably benign 0.01
R7381:Ano7 UTSW 1 93395335 missense probably benign
R7832:Ano7 UTSW 1 93394473 missense probably benign 0.06
R8700:Ano7 UTSW 1 93388607 missense probably damaging 1.00
Z1176:Ano7 UTSW 1 93394465 missense probably benign 0.26
Z1177:Ano7 UTSW 1 93401527 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGCGGGAGAACTAGCAG -3'
(R):5'- GGTCTATGGAAGCTAGCTGG -3'

Sequencing Primer
(F):5'- CAGTGGAGAAGCCCAGACC -3'
(R):5'- CTATGGAAGCTAGCTGGGGTCAC -3'
Posted On2019-11-12